Incidental Mutation 'R1603:Cntnap5a'
ID176234
Institutional Source Beutler Lab
Gene Symbol Cntnap5a
Ensembl Gene ENSMUSG00000070695
Gene Namecontactin associated protein-like 5A
SynonymsCaspr5-1
MMRRC Submission 039640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R1603 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location115684756-116587323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 116412101 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 697 (T697P)
Ref Sequence ENSEMBL: ENSMUSP00000035732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043725]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043725
AA Change: T697P

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035732
Gene: ENSMUSG00000070695
AA Change: T697P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 33 174 1.63e-13 SMART
LamG 201 338 1.4e-26 SMART
LamG 388 522 1.5e-26 SMART
EGF 550 584 2.16e-1 SMART
Blast:FBG 587 772 2e-81 BLAST
LamG 812 939 1.54e-28 SMART
EGF 960 996 2.28e0 SMART
LamG 1037 1173 4.73e-15 SMART
transmembrane domain 1241 1263 N/A INTRINSIC
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4931408C20Rik T A 1: 26,685,569 R177W probably damaging Het
Ace T A 11: 105,972,099 S315R probably benign Het
Adamtsl1 A G 4: 86,415,530 I1491V probably benign Het
Adrb2 A T 18: 62,179,508 M82K probably damaging Het
Aebp2 A G 6: 140,642,253 N350D probably damaging Het
Ankrd42 T C 7: 92,619,691 probably benign Het
Asap1 A T 15: 64,129,257 C492S probably damaging Het
Atp8b3 C A 10: 80,525,785 A768S probably benign Het
Chga T A 12: 102,564,607 probably null Het
Clca4b A G 3: 144,922,019 V397A probably benign Het
Col12a1 T C 9: 79,612,962 Q2810R probably damaging Het
Dchs1 G T 7: 105,762,770 R1380S probably benign Het
Dgkg T A 16: 22,570,159 probably benign Het
Dlgap3 G A 4: 127,195,228 G206R probably damaging Het
Dnah5 A G 15: 28,294,985 probably benign Het
Dnah5 A T 15: 28,449,180 I4243L probably benign Het
Fbxw22 G T 9: 109,378,847 P452H probably benign Het
Fgl1 T A 8: 41,197,018 D242V probably damaging Het
Gba2 C T 4: 43,567,823 G794R probably damaging Het
Gimap7 A T 6: 48,723,930 D150V probably damaging Het
Gm5334 T C 7: 68,618,872 V13A probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Grk5 T C 19: 61,069,362 F167L probably benign Het
Ice1 A G 13: 70,603,353 L1538P probably benign Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Kmt2a A T 9: 44,841,561 probably null Het
Kras A T 6: 145,225,145 L168* probably null Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Mak T C 13: 41,042,106 D377G possibly damaging Het
Matn2 T C 15: 34,388,768 C335R probably damaging Het
Mcoln2 C T 3: 146,180,222 S276F probably damaging Het
Morc3 C A 16: 93,866,503 N531K probably benign Het
Obp2a G A 2: 25,702,745 S175N probably benign Het
Olfr1437 A T 19: 12,321,984 V281E probably damaging Het
Olfr319 T C 11: 58,702,460 V253A probably benign Het
Olfr733 T G 14: 50,299,034 I92L possibly damaging Het
Osbpl3 C A 6: 50,323,093 K510N probably damaging Het
Papd4 G A 13: 93,175,565 A209V probably benign Het
Pcnx2 G A 8: 125,839,626 S1026F probably damaging Het
Pom121l2 A T 13: 21,983,344 D595V probably damaging Het
Poteg T A 8: 27,448,005 M1K probably null Het
Rbl1 G A 2: 157,175,659 L547F possibly damaging Het
Rpap3 T C 15: 97,701,121 T82A possibly damaging Het
Sema7a G A 9: 57,960,676 D512N probably benign Het
Sgpl1 C T 10: 61,105,451 V294M possibly damaging Het
Slc22a28 A G 19: 8,063,309 S526P probably damaging Het
Trim30b T G 7: 104,365,812 Q123P possibly damaging Het
Trpm5 A G 7: 143,085,209 L275P probably benign Het
Ttc33 A G 15: 5,189,794 E71G probably damaging Het
Unc13d T C 11: 116,073,655 T288A possibly damaging Het
Unc93a T A 17: 13,109,634 E444V probably benign Het
Usf3 T A 16: 44,218,172 M1005K probably benign Het
Vmn2r91 T C 17: 18,106,143 I230T probably benign Het
Wdr49 G A 3: 75,396,870 Q448* probably null Het
Zfp939 T A 7: 39,473,271 noncoding transcript Het
Other mutations in Cntnap5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Cntnap5a APN 1 116117677 missense possibly damaging 0.48
IGL00929:Cntnap5a APN 1 116060274 splice site probably null
IGL00959:Cntnap5a APN 1 116184327 missense probably benign 0.00
IGL01721:Cntnap5a APN 1 116157637 missense probably benign
IGL02009:Cntnap5a APN 1 116157494 missense probably benign 0.15
IGL02111:Cntnap5a APN 1 116089352 missense probably benign 0.00
IGL02198:Cntnap5a APN 1 116580532 missense probably benign
IGL02751:Cntnap5a APN 1 116184457 critical splice donor site probably null
IGL02752:Cntnap5a APN 1 116580531 missense probably benign 0.00
IGL02989:Cntnap5a APN 1 116412083 splice site probably benign
IGL03195:Cntnap5a APN 1 116157448 missense probably benign 0.00
PIT4142001:Cntnap5a UTSW 1 115684956 start gained probably benign
R0294:Cntnap5a UTSW 1 115915316 missense probably benign
R0377:Cntnap5a UTSW 1 116292529 missense probably benign 0.04
R0597:Cntnap5a UTSW 1 116184461 splice site probably benign
R0616:Cntnap5a UTSW 1 116580549 missense possibly damaging 0.80
R0725:Cntnap5a UTSW 1 116292476 missense probably benign 0.25
R0842:Cntnap5a UTSW 1 116442223 missense probably damaging 0.96
R1103:Cntnap5a UTSW 1 116580669 missense possibly damaging 0.81
R1265:Cntnap5a UTSW 1 116428518 missense possibly damaging 0.49
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1467:Cntnap5a UTSW 1 115685168 nonsense probably null
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1470:Cntnap5a UTSW 1 116259519 missense probably damaging 1.00
R1474:Cntnap5a UTSW 1 116442373 nonsense probably null
R1476:Cntnap5a UTSW 1 115901020 missense probably damaging 1.00
R1481:Cntnap5a UTSW 1 116117663 missense probably damaging 1.00
R1512:Cntnap5a UTSW 1 115900950 missense probably benign
R1526:Cntnap5a UTSW 1 116428477 missense probably benign
R1589:Cntnap5a UTSW 1 116060200 missense possibly damaging 0.77
R1728:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1728:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1729:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1729:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1730:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1730:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1739:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1739:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1762:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1762:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1783:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1783:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1785:Cntnap5a UTSW 1 116455004 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455101 missense probably benign 0.00
R1785:Cntnap5a UTSW 1 116455143 missense probably benign 0.01
R1816:Cntnap5a UTSW 1 116428888 missense probably benign 0.19
R1872:Cntnap5a UTSW 1 116089210 missense probably benign 0.02
R2095:Cntnap5a UTSW 1 116442260 missense probably damaging 1.00
R2113:Cntnap5a UTSW 1 116188365 missense probably damaging 0.98
R2144:Cntnap5a UTSW 1 116101710 missense probably benign 0.14
R2171:Cntnap5a UTSW 1 116188402 missense possibly damaging 0.95
R2219:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2220:Cntnap5a UTSW 1 116580639 missense possibly damaging 0.83
R2571:Cntnap5a UTSW 1 116184362 missense probably damaging 1.00
R3019:Cntnap5a UTSW 1 116101569 missense probably benign
R3827:Cntnap5a UTSW 1 116117679 missense probably benign 0.14
R3870:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R3871:Cntnap5a UTSW 1 116060249 missense probably damaging 1.00
R4041:Cntnap5a UTSW 1 116184399 missense probably benign 0.00
R4080:Cntnap5a UTSW 1 116101574 missense probably benign 0.01
R4260:Cntnap5a UTSW 1 116446595 missense probably benign 0.31
R4685:Cntnap5a UTSW 1 116446680 missense possibly damaging 0.69
R4781:Cntnap5a UTSW 1 116412201 missense possibly damaging 0.88
R4785:Cntnap5a UTSW 1 116101565 missense probably benign 0.00
R5057:Cntnap5a UTSW 1 115685213 missense probably benign 0.10
R5059:Cntnap5a UTSW 1 116428494 missense probably benign 0.44
R5101:Cntnap5a UTSW 1 116442296 missense probably benign 0.00
R5302:Cntnap5a UTSW 1 116157570 missense probably benign 0.15
R5451:Cntnap5a UTSW 1 115685143 missense probably benign
R5473:Cntnap5a UTSW 1 116089256 missense probably benign 0.12
R5886:Cntnap5a UTSW 1 116571672 critical splice donor site probably null
R6311:Cntnap5a UTSW 1 116412106 nonsense probably null
R6464:Cntnap5a UTSW 1 116184408 missense probably benign
R6497:Cntnap5a UTSW 1 116577897 missense probably damaging 1.00
R6781:Cntnap5a UTSW 1 116292397 missense probably benign 0.05
Z1088:Cntnap5a UTSW 1 116060251 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGTGGGTGGGGAAGAGAACCTTT -3'
(R):5'- TCATGAAGAATGTGGGGTTACAGAGACA -3'

Sequencing Primer
(F):5'- GGGAAGAGAACCTTTATATGTACAC -3'
(R):5'- tctccttctccttctcctctc -3'
Posted On2014-04-24