Incidental Mutation 'R1603:Gimap7'
ID176247
Institutional Source Beutler Lab
Gene Symbol Gimap7
Ensembl Gene ENSMUSG00000043931
Gene NameGTPase, IMAP family member 7
SynonymsIAN7, Ian3
MMRRC Submission 039640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R1603 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48718621-48724636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48723930 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 150 (D150V)
Ref Sequence ENSEMBL: ENSMUSP00000057143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052503] [ENSMUST00000127537] [ENSMUST00000204785]
Predicted Effect probably damaging
Transcript: ENSMUST00000052503
AA Change: D150V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057143
Gene: ENSMUSG00000043931
AA Change: D150V

DomainStartEndE-ValueType
Pfam:AIG1 9 218 1.2e-82 PFAM
Pfam:MMR_HSR1 10 144 8.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204317
Predicted Effect probably benign
Transcript: ENSMUST00000204785
SMART Domains Protein: ENSMUSP00000145238
Gene: ENSMUSG00000043931

DomainStartEndE-ValueType
Pfam:FeoB_N 9 82 7.2e-5 PFAM
Pfam:AIG1 9 86 3.9e-31 PFAM
Pfam:MMR_HSR1 10 86 7.5e-10 PFAM
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4931408C20Rik T A 1: 26,685,569 R177W probably damaging Het
Ace T A 11: 105,972,099 S315R probably benign Het
Adamtsl1 A G 4: 86,415,530 I1491V probably benign Het
Adrb2 A T 18: 62,179,508 M82K probably damaging Het
Aebp2 A G 6: 140,642,253 N350D probably damaging Het
Ankrd42 T C 7: 92,619,691 probably benign Het
Asap1 A T 15: 64,129,257 C492S probably damaging Het
Atp8b3 C A 10: 80,525,785 A768S probably benign Het
Chga T A 12: 102,564,607 probably null Het
Clca4b A G 3: 144,922,019 V397A probably benign Het
Cntnap5a A C 1: 116,412,101 T697P possibly damaging Het
Col12a1 T C 9: 79,612,962 Q2810R probably damaging Het
Dchs1 G T 7: 105,762,770 R1380S probably benign Het
Dgkg T A 16: 22,570,159 probably benign Het
Dlgap3 G A 4: 127,195,228 G206R probably damaging Het
Dnah5 A G 15: 28,294,985 probably benign Het
Dnah5 A T 15: 28,449,180 I4243L probably benign Het
Fbxw22 G T 9: 109,378,847 P452H probably benign Het
Fgl1 T A 8: 41,197,018 D242V probably damaging Het
Gba2 C T 4: 43,567,823 G794R probably damaging Het
Gm5334 T C 7: 68,618,872 V13A probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Grk5 T C 19: 61,069,362 F167L probably benign Het
Ice1 A G 13: 70,603,353 L1538P probably benign Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Kmt2a A T 9: 44,841,561 probably null Het
Kras A T 6: 145,225,145 L168* probably null Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Mak T C 13: 41,042,106 D377G possibly damaging Het
Matn2 T C 15: 34,388,768 C335R probably damaging Het
Mcoln2 C T 3: 146,180,222 S276F probably damaging Het
Morc3 C A 16: 93,866,503 N531K probably benign Het
Obp2a G A 2: 25,702,745 S175N probably benign Het
Olfr1437 A T 19: 12,321,984 V281E probably damaging Het
Olfr319 T C 11: 58,702,460 V253A probably benign Het
Olfr733 T G 14: 50,299,034 I92L possibly damaging Het
Osbpl3 C A 6: 50,323,093 K510N probably damaging Het
Papd4 G A 13: 93,175,565 A209V probably benign Het
Pcnx2 G A 8: 125,839,626 S1026F probably damaging Het
Pom121l2 A T 13: 21,983,344 D595V probably damaging Het
Poteg T A 8: 27,448,005 M1K probably null Het
Rbl1 G A 2: 157,175,659 L547F possibly damaging Het
Rpap3 T C 15: 97,701,121 T82A possibly damaging Het
Sema7a G A 9: 57,960,676 D512N probably benign Het
Sgpl1 C T 10: 61,105,451 V294M possibly damaging Het
Slc22a28 A G 19: 8,063,309 S526P probably damaging Het
Trim30b T G 7: 104,365,812 Q123P possibly damaging Het
Trpm5 A G 7: 143,085,209 L275P probably benign Het
Ttc33 A G 15: 5,189,794 E71G probably damaging Het
Unc13d T C 11: 116,073,655 T288A possibly damaging Het
Unc93a T A 17: 13,109,634 E444V probably benign Het
Usf3 T A 16: 44,218,172 M1005K probably benign Het
Vmn2r91 T C 17: 18,106,143 I230T probably benign Het
Wdr49 G A 3: 75,396,870 Q448* probably null Het
Zfp939 T A 7: 39,473,271 noncoding transcript Het
Other mutations in Gimap7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Gimap7 APN 6 48723733 nonsense probably null
IGL01508:Gimap7 APN 6 48724296 missense probably damaging 0.98
IGL03134:Gimap7 UTSW 6 48723501 missense probably benign 0.04
R0848:Gimap7 UTSW 6 48723723 missense probably damaging 0.99
R1590:Gimap7 UTSW 6 48724019 missense probably damaging 0.96
R1874:Gimap7 UTSW 6 48723515 missense possibly damaging 0.81
R1982:Gimap7 UTSW 6 48724241 missense possibly damaging 0.83
R2471:Gimap7 UTSW 6 48724052 missense probably damaging 0.99
R3888:Gimap7 UTSW 6 48723845 missense probably benign 0.05
R5512:Gimap7 UTSW 6 48723596 missense probably benign 0.07
R6378:Gimap7 UTSW 6 48724182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTGCAACTGAACCGCTTCAC -3'
(R):5'- ACACTGAATCCCTGGCTTTGCTATC -3'

Sequencing Primer
(F):5'- CGCTTCACGGTGGAAGAG -3'
(R):5'- TCCTGAGCACTAAATTTCCTAAGAGC -3'
Posted On2014-04-24