Incidental Mutation 'R1604:Olfr891'
ID176339
Institutional Source Beutler Lab
Gene Symbol Olfr891
Ensembl Gene ENSMUSG00000045528
Gene Nameolfactory receptor 891
SynonymsGA_x6K02T2PVTD-31862167-31861217, MOR170-9
MMRRC Submission 039641-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1604 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38179871-38180821 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38180349 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 158 (V158A)
Ref Sequence ENSEMBL: ENSMUSP00000055451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062535]
Predicted Effect probably benign
Transcript: ENSMUST00000062535
AA Change: V158A

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055451
Gene: ENSMUSG00000045528
AA Change: V158A

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1e-37 PFAM
Pfam:7tm_1 41 289 9.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182282
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T C 15: 84,406,471 M212V probably benign Het
Aldoart2 A G 12: 55,565,620 D110G probably damaging Het
Angptl2 T C 2: 33,243,773 M369T possibly damaging Het
Anks3 C T 16: 4,948,253 V151M probably damaging Het
Arl6ip6 T C 2: 53,192,496 L125P probably damaging Het
Bmp1 T C 14: 70,508,004 Q247R possibly damaging Het
Ccdc30 A G 4: 119,331,596 I491T probably damaging Het
Cdhr1 T A 14: 37,095,093 I104F probably benign Het
Cdk17 G T 10: 93,232,498 M372I probably damaging Het
Cyp2c54 A G 19: 40,070,343 V215A probably benign Het
D430041D05Rik T A 2: 104,205,142 I1614F probably damaging Het
Ddx55 A G 5: 124,559,306 N244D probably damaging Het
Dopey2 G T 16: 93,762,570 V617F probably benign Het
Erbb4 G T 1: 68,346,569 A287E possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gad2 T C 2: 22,623,840 probably null Het
Gm17421 G A 12: 113,369,535 noncoding transcript Het
Gm9894 T A 13: 67,764,889 noncoding transcript Het
Gnpat T C 8: 124,876,961 S193P probably damaging Het
Gpr20 C T 15: 73,696,004 V179M probably damaging Het
Hdgf T A 3: 87,914,040 probably null Het
Itgb8 A T 12: 119,202,530 L89M probably damaging Het
Lnx2 T C 5: 147,029,325 D328G probably benign Het
Lrguk A G 6: 34,072,370 T341A possibly damaging Het
Map1b A G 13: 99,429,572 S2214P unknown Het
Mms22l T C 4: 24,502,804 F131L probably damaging Het
Msmo1 A G 8: 64,727,655 I75T probably damaging Het
Olfr444 G A 6: 42,955,716 A73T possibly damaging Het
Olfr639 G T 7: 104,011,955 A249E probably damaging Het
Olfr924 T G 9: 38,848,704 F197V probably benign Het
Olfr934 A T 9: 38,982,618 M142K probably benign Het
Pkhd1l1 C T 15: 44,467,367 R113* probably null Het
Polr2m T C 9: 71,483,677 D81G probably damaging Het
Ppp1r15b T A 1: 133,132,549 M268K probably benign Het
Ptprcap T A 19: 4,156,074 L52* probably null Het
Rasgrp2 C T 19: 6,407,057 T277I possibly damaging Het
Rrbp1 T C 2: 143,989,390 N286D probably damaging Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Scrib A C 15: 76,048,240 S1557A probably damaging Het
Sergef C A 7: 46,443,359 V409L probably benign Het
Slc6a13 A G 6: 121,332,369 M280V probably benign Het
Slc9a8 C T 2: 167,471,432 P409S probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Spc25 T C 2: 69,205,154 D4G probably damaging Het
Specc1 C T 11: 62,043,057 R88C probably damaging Het
Srsf11 C T 3: 158,019,311 probably null Het
Stt3b T C 9: 115,250,927 E639G probably damaging Het
Sult3a1 A C 10: 33,866,620 E81A probably damaging Het
Taf1b G A 12: 24,556,624 G481D probably benign Het
Tgm4 T C 9: 123,045,064 V123A probably benign Het
Tie1 G T 4: 118,474,407 H973N probably damaging Het
Tmem117 C T 15: 95,094,544 R362W probably damaging Het
Txnip A T 3: 96,558,961 Q107L probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vcan A G 13: 89,689,661 V1628A probably benign Het
Vmn2r115 T A 17: 23,345,271 M139K probably benign Het
Wwp1 A G 4: 19,659,709 V193A probably benign Het
Zcchc8 C T 5: 123,700,658 A606T probably benign Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp518b T C 5: 38,673,606 D352G probably damaging Het
Zfp784 A G 7: 5,036,454 probably benign Het
Zfp940 A T 7: 29,846,075 F136I probably benign Het
Other mutations in Olfr891
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02821:Olfr891 APN 9 38180668 missense possibly damaging 0.65
IGL02987:Olfr891 APN 9 38180623 missense possibly damaging 0.89
R0032:Olfr891 UTSW 9 38180608 missense probably damaging 1.00
R1678:Olfr891 UTSW 9 38180637 missense possibly damaging 0.65
R2230:Olfr891 UTSW 9 38180146 missense probably benign 0.00
R4391:Olfr891 UTSW 9 38180349 missense probably damaging 0.99
R4470:Olfr891 UTSW 9 38180370 missense probably damaging 0.96
R4803:Olfr891 UTSW 9 38180250 missense probably damaging 1.00
R4865:Olfr891 UTSW 9 38179900 missense possibly damaging 0.53
R5652:Olfr891 UTSW 9 38180815 missense probably benign 0.01
R5743:Olfr891 UTSW 9 38180718 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTTTGGACAAACCCTTACCTG -3'
(R):5'- CTGGACTGACAGAGCAACCTGAAC -3'

Sequencing Primer
(F):5'- AACCCTTACCTGATAACTGAGTG -3'
(R):5'- TTTACAGGATGCATGACACAGC -3'
Posted On2014-04-24