Incidental Mutation 'R1604:Stt3b'
ID176343
Institutional Source Beutler Lab
Gene Symbol Stt3b
Ensembl Gene ENSMUSG00000032437
Gene NameSTT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
Synonyms1300006C19Rik, Simp
MMRRC Submission 039641-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #R1604 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location115242581-115310421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115250927 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 639 (E639G)
Ref Sequence ENSEMBL: ENSMUSP00000035010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035010]
Predicted Effect probably damaging
Transcript: ENSMUST00000035010
AA Change: E639G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035010
Gene: ENSMUSG00000032437
AA Change: E639G

DomainStartEndE-ValueType
low complexity region 40 60 N/A INTRINSIC
Pfam:STT3 68 560 2e-151 PFAM
low complexity region 807 821 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a catalytic subunit of a protein complex that transfers oligosaccharides onto asparagine residues. Defects in this gene are a cause of congenital disorder of glycosylation Ix (CDG1X). [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T C 15: 84,406,471 M212V probably benign Het
Aldoart2 A G 12: 55,565,620 D110G probably damaging Het
Angptl2 T C 2: 33,243,773 M369T possibly damaging Het
Anks3 C T 16: 4,948,253 V151M probably damaging Het
Arl6ip6 T C 2: 53,192,496 L125P probably damaging Het
Bmp1 T C 14: 70,508,004 Q247R possibly damaging Het
Ccdc30 A G 4: 119,331,596 I491T probably damaging Het
Cdhr1 T A 14: 37,095,093 I104F probably benign Het
Cdk17 G T 10: 93,232,498 M372I probably damaging Het
Cyp2c54 A G 19: 40,070,343 V215A probably benign Het
D430041D05Rik T A 2: 104,205,142 I1614F probably damaging Het
Ddx55 A G 5: 124,559,306 N244D probably damaging Het
Dopey2 G T 16: 93,762,570 V617F probably benign Het
Erbb4 G T 1: 68,346,569 A287E possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gad2 T C 2: 22,623,840 probably null Het
Gm17421 G A 12: 113,369,535 noncoding transcript Het
Gm9894 T A 13: 67,764,889 noncoding transcript Het
Gnpat T C 8: 124,876,961 S193P probably damaging Het
Gpr20 C T 15: 73,696,004 V179M probably damaging Het
Hdgf T A 3: 87,914,040 probably null Het
Itgb8 A T 12: 119,202,530 L89M probably damaging Het
Lnx2 T C 5: 147,029,325 D328G probably benign Het
Lrguk A G 6: 34,072,370 T341A possibly damaging Het
Map1b A G 13: 99,429,572 S2214P unknown Het
Mms22l T C 4: 24,502,804 F131L probably damaging Het
Msmo1 A G 8: 64,727,655 I75T probably damaging Het
Olfr444 G A 6: 42,955,716 A73T possibly damaging Het
Olfr639 G T 7: 104,011,955 A249E probably damaging Het
Olfr891 A G 9: 38,180,349 V158A probably benign Het
Olfr924 T G 9: 38,848,704 F197V probably benign Het
Olfr934 A T 9: 38,982,618 M142K probably benign Het
Pkhd1l1 C T 15: 44,467,367 R113* probably null Het
Polr2m T C 9: 71,483,677 D81G probably damaging Het
Ppp1r15b T A 1: 133,132,549 M268K probably benign Het
Ptprcap T A 19: 4,156,074 L52* probably null Het
Rasgrp2 C T 19: 6,407,057 T277I possibly damaging Het
Rrbp1 T C 2: 143,989,390 N286D probably damaging Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Scrib A C 15: 76,048,240 S1557A probably damaging Het
Sergef C A 7: 46,443,359 V409L probably benign Het
Slc6a13 A G 6: 121,332,369 M280V probably benign Het
Slc9a8 C T 2: 167,471,432 P409S probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Spc25 T C 2: 69,205,154 D4G probably damaging Het
Specc1 C T 11: 62,043,057 R88C probably damaging Het
Srsf11 C T 3: 158,019,311 probably null Het
Sult3a1 A C 10: 33,866,620 E81A probably damaging Het
Taf1b G A 12: 24,556,624 G481D probably benign Het
Tgm4 T C 9: 123,045,064 V123A probably benign Het
Tie1 G T 4: 118,474,407 H973N probably damaging Het
Tmem117 C T 15: 95,094,544 R362W probably damaging Het
Txnip A T 3: 96,558,961 Q107L probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vcan A G 13: 89,689,661 V1628A probably benign Het
Vmn2r115 T A 17: 23,345,271 M139K probably benign Het
Wwp1 A G 4: 19,659,709 V193A probably benign Het
Zcchc8 C T 5: 123,700,658 A606T probably benign Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp518b T C 5: 38,673,606 D352G probably damaging Het
Zfp784 A G 7: 5,036,454 probably benign Het
Zfp940 A T 7: 29,846,075 F136I probably benign Het
Other mutations in Stt3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Stt3b APN 9 115251847 missense probably benign 0.42
IGL00929:Stt3b APN 9 115266165 missense probably damaging 1.00
IGL01333:Stt3b APN 9 115257544 missense probably damaging 0.97
IGL01389:Stt3b APN 9 115253900 missense probably benign
IGL01680:Stt3b APN 9 115246261 splice site probably benign
IGL01980:Stt3b APN 9 115276699 splice site probably null
IGL02351:Stt3b APN 9 115250907 missense possibly damaging 0.90
IGL02358:Stt3b APN 9 115250907 missense possibly damaging 0.90
IGL02421:Stt3b APN 9 115251852 splice site probably benign
IGL02602:Stt3b APN 9 115276778 missense probably damaging 1.00
IGL03231:Stt3b APN 9 115243994 missense unknown
R0482:Stt3b UTSW 9 115248567 missense probably benign 0.10
R1221:Stt3b UTSW 9 115257499 missense probably benign 0.00
R1437:Stt3b UTSW 9 115254927 missense probably damaging 1.00
R1477:Stt3b UTSW 9 115266192 missense probably damaging 1.00
R1796:Stt3b UTSW 9 115248607 nonsense probably null
R4112:Stt3b UTSW 9 115266138 missense probably damaging 1.00
R4166:Stt3b UTSW 9 115254901 missense probably damaging 1.00
R4695:Stt3b UTSW 9 115254794 missense probably damaging 1.00
R5183:Stt3b UTSW 9 115266143 missense probably damaging 0.99
R5317:Stt3b UTSW 9 115252510 nonsense probably null
R5631:Stt3b UTSW 9 115254845 missense probably benign 0.05
R5665:Stt3b UTSW 9 115266147 missense probably damaging 1.00
R6495:Stt3b UTSW 9 115267320 missense possibly damaging 0.46
R6517:Stt3b UTSW 9 115267342 missense probably benign
R6525:Stt3b UTSW 9 115258558 missense probably damaging 1.00
R6592:Stt3b UTSW 9 115252511 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTTTCACAGACAAGCTGCTACC -3'
(R):5'- GTTATGGAAATCACAGGCCAGGCTC -3'

Sequencing Primer
(F):5'- AGGCTTCCAAATCCGAAGTG -3'
(R):5'- GGAGAAAACTGTCTCTGAATGCTTG -3'
Posted On2014-04-24