Incidental Mutation 'R1604:Bmp1'
ID176357
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Namebone morphogenetic protein 1
Synonyms
MMRRC Submission 039641-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1604 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location70474558-70520234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70508004 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 247 (Q247R)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226246] [ENSMUST00000226906] [ENSMUST00000227944]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022693
AA Change: Q247R

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: Q247R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226539
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik T C 15: 84,406,471 M212V probably benign Het
Aldoart2 A G 12: 55,565,620 D110G probably damaging Het
Angptl2 T C 2: 33,243,773 M369T possibly damaging Het
Anks3 C T 16: 4,948,253 V151M probably damaging Het
Arl6ip6 T C 2: 53,192,496 L125P probably damaging Het
Ccdc30 A G 4: 119,331,596 I491T probably damaging Het
Cdhr1 T A 14: 37,095,093 I104F probably benign Het
Cdk17 G T 10: 93,232,498 M372I probably damaging Het
Cyp2c54 A G 19: 40,070,343 V215A probably benign Het
D430041D05Rik T A 2: 104,205,142 I1614F probably damaging Het
Ddx55 A G 5: 124,559,306 N244D probably damaging Het
Dopey2 G T 16: 93,762,570 V617F probably benign Het
Erbb4 G T 1: 68,346,569 A287E possibly damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gad2 T C 2: 22,623,840 probably null Het
Gm17421 G A 12: 113,369,535 noncoding transcript Het
Gm9894 T A 13: 67,764,889 noncoding transcript Het
Gnpat T C 8: 124,876,961 S193P probably damaging Het
Gpr20 C T 15: 73,696,004 V179M probably damaging Het
Hdgf T A 3: 87,914,040 probably null Het
Itgb8 A T 12: 119,202,530 L89M probably damaging Het
Lnx2 T C 5: 147,029,325 D328G probably benign Het
Lrguk A G 6: 34,072,370 T341A possibly damaging Het
Map1b A G 13: 99,429,572 S2214P unknown Het
Mms22l T C 4: 24,502,804 F131L probably damaging Het
Msmo1 A G 8: 64,727,655 I75T probably damaging Het
Olfr444 G A 6: 42,955,716 A73T possibly damaging Het
Olfr639 G T 7: 104,011,955 A249E probably damaging Het
Olfr891 A G 9: 38,180,349 V158A probably benign Het
Olfr924 T G 9: 38,848,704 F197V probably benign Het
Olfr934 A T 9: 38,982,618 M142K probably benign Het
Pkhd1l1 C T 15: 44,467,367 R113* probably null Het
Polr2m T C 9: 71,483,677 D81G probably damaging Het
Ppp1r15b T A 1: 133,132,549 M268K probably benign Het
Ptprcap T A 19: 4,156,074 L52* probably null Het
Rasgrp2 C T 19: 6,407,057 T277I possibly damaging Het
Rrbp1 T C 2: 143,989,390 N286D probably damaging Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Scrib A C 15: 76,048,240 S1557A probably damaging Het
Sergef C A 7: 46,443,359 V409L probably benign Het
Slc6a13 A G 6: 121,332,369 M280V probably benign Het
Slc9a8 C T 2: 167,471,432 P409S probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Spc25 T C 2: 69,205,154 D4G probably damaging Het
Specc1 C T 11: 62,043,057 R88C probably damaging Het
Srsf11 C T 3: 158,019,311 probably null Het
Stt3b T C 9: 115,250,927 E639G probably damaging Het
Sult3a1 A C 10: 33,866,620 E81A probably damaging Het
Taf1b G A 12: 24,556,624 G481D probably benign Het
Tgm4 T C 9: 123,045,064 V123A probably benign Het
Tie1 G T 4: 118,474,407 H973N probably damaging Het
Tmem117 C T 15: 95,094,544 R362W probably damaging Het
Txnip A T 3: 96,558,961 Q107L probably benign Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vcan A G 13: 89,689,661 V1628A probably benign Het
Vmn2r115 T A 17: 23,345,271 M139K probably benign Het
Wwp1 A G 4: 19,659,709 V193A probably benign Het
Zcchc8 C T 5: 123,700,658 A606T probably benign Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp518b T C 5: 38,673,606 D352G probably damaging Het
Zfp784 A G 7: 5,036,454 probably benign Het
Zfp940 A T 7: 29,846,075 F136I probably benign Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70492461 missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70486220 missense probably damaging 0.97
IGL02065:Bmp1 APN 14 70490107 missense probably damaging 0.99
IGL02349:Bmp1 APN 14 70507549 missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70504776 missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70490029 missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70490034 missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R1732:Bmp1 UTSW 14 70486265 missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70508831 missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70492466 missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70486272 missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70492107 missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70490542 splice site probably null
R4609:Bmp1 UTSW 14 70477966 missense probably benign 0.00
R4613:Bmp1 UTSW 14 70508523 missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70492844 missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70492073 splice site probably null
R4884:Bmp1 UTSW 14 70475215 missense probably benign 0.01
R4905:Bmp1 UTSW 14 70491362 missense probably benign 0.06
R5088:Bmp1 UTSW 14 70486219 missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70480165 missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70508128 missense probably benign 0.34
R5625:Bmp1 UTSW 14 70486166 missense probably benign 0.19
R5653:Bmp1 UTSW 14 70490094 missense probably benign 0.00
R6155:Bmp1 UTSW 14 70508007 missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70491383 missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70491368 missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70490618 missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70508858 missense probably benign 0.26
R6983:Bmp1 UTSW 14 70508207 missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70479560 missense possibly damaging 0.56
X0028:Bmp1 UTSW 14 70508537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCAGAAAAGCCTGGAGAACTTG -3'
(R):5'- CTGCCATTGATATGGCTCAGACCC -3'

Sequencing Primer
(F):5'- GCCTGGAGAACTTGCTGAAG -3'
(R):5'- CTGGCAAAAAGCCTGCG -3'
Posted On2014-04-24