Incidental Mutation 'R1605:Ankrd44'
ID176374
Institutional Source Beutler Lab
Gene Symbol Ankrd44
Ensembl Gene ENSMUSG00000052331
Gene Nameankyrin repeat domain 44
SynonymsE130014H08Rik
MMRRC Submission 039642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R1605 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location54645340-54926387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54828622 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 34 (V34A)
Ref Sequence ENSEMBL: ENSMUSP00000137616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044359] [ENSMUST00000177679] [ENSMUST00000179030]
Predicted Effect probably benign
Transcript: ENSMUST00000044359
AA Change: V34A

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040327
Gene: ENSMUSG00000052331
AA Change: V34A

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 5.98e1 SMART
ANK 422 451 7.13e-6 SMART
ANK 455 484 1.18e-6 SMART
ANK 488 545 1.17e2 SMART
ANK 549 579 3.31e-1 SMART
ANK 584 613 3.91e-3 SMART
ANK 617 646 1.43e-5 SMART
ANK 651 680 2.73e-2 SMART
ANK 687 716 5.41e-6 SMART
ANK 720 749 5.53e-3 SMART
ANK 753 785 1.52e0 SMART
ANK 789 819 9.27e-5 SMART
ANK 821 851 1.52e0 SMART
ANK 856 885 6.02e-4 SMART
ANK 889 919 3.08e-1 SMART
ANK 923 955 3.36e-2 SMART
ANK 959 988 6.26e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177679
AA Change: V9A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137216
Gene: ENSMUSG00000052331
AA Change: V9A

DomainStartEndE-ValueType
ANK 15 44 3.23e-4 SMART
ANK 48 77 1.12e-3 SMART
ANK 81 110 1.65e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178935
Predicted Effect probably benign
Transcript: ENSMUST00000179030
AA Change: V34A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137616
Gene: ENSMUSG00000052331
AA Change: V34A

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 3.26e0 SMART
ANK 404 433 7.13e-6 SMART
ANK 437 466 1.18e-6 SMART
ANK 470 527 1.17e2 SMART
ANK 531 561 3.31e-1 SMART
ANK 566 595 3.91e-3 SMART
ANK 599 628 1.43e-5 SMART
ANK 633 662 2.73e-2 SMART
ANK 669 698 5.41e-6 SMART
ANK 702 731 5.53e-3 SMART
ANK 735 767 1.52e0 SMART
ANK 771 801 9.27e-5 SMART
ANK 803 833 1.52e0 SMART
ANK 838 867 6.02e-4 SMART
ANK 871 901 3.08e-1 SMART
ANK 905 937 3.36e-2 SMART
ANK 941 970 6.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180327
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik T A 7: 4,151,396 H131L probably benign Het
1700123L14Rik A G 6: 96,164,812 M417T probably benign Het
4931408C20Rik A T 1: 26,684,430 H556Q possibly damaging Het
5730409E04Rik A G 4: 126,612,311 K211E probably damaging Het
Acot7 A G 4: 152,206,828 I84V possibly damaging Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Atr T A 9: 95,936,463 I2163K probably damaging Het
Azgp1 A T 5: 137,985,164 R34* probably null Het
Ccdc152 T G 15: 3,298,121 K58T probably damaging Het
Ccdc88b T A 19: 6,850,469 Q912L probably benign Het
Chd7 G A 4: 8,844,675 E1595K probably damaging Het
Col11a1 G A 3: 114,131,641 G41D probably damaging Het
Cyp2b23 C T 7: 26,686,418 V5I probably benign Het
D430041D05Rik A G 2: 104,255,570 V22A possibly damaging Het
Ddi1 T C 9: 6,266,012 Y119C probably benign Het
Dysf T C 6: 84,106,941 L785P probably damaging Het
Eqtn T A 4: 94,928,350 T69S possibly damaging Het
F11 T A 8: 45,241,580 K581N probably damaging Het
Gli2 G A 1: 118,854,560 P172S probably damaging Het
Gm10093 A G 17: 78,492,108 D176G probably damaging Het
Gm7579 G T 7: 142,211,866 C3F unknown Het
Grin2a A G 16: 9,663,330 V501A possibly damaging Het
Grk4 G A 5: 34,674,557 D57N probably damaging Het
Gsdma A T 11: 98,666,493 D86V probably damaging Het
Gsx1 A G 5: 147,189,928 E187G probably damaging Het
Inpp5k T A 11: 75,633,481 F75L probably benign Het
Itpr1 T C 6: 108,349,659 V114A possibly damaging Het
Izumo3 A T 4: 92,144,740 C130S probably damaging Het
Mei4 G A 9: 81,927,586 E241K possibly damaging Het
Mocs2 T C 13: 114,824,584 V39A probably benign Het
Mroh2b G A 15: 4,945,090 R1184H probably benign Het
Msh3 T C 13: 92,300,275 Q509R probably null Het
Myh8 T C 11: 67,301,671 W1459R probably damaging Het
Mypop T A 7: 19,000,993 probably benign Het
Ndc1 C A 4: 107,368,096 T3K probably damaging Het
Nf1 A C 11: 79,440,923 M695L probably benign Het
Nutm2 C A 13: 50,469,919 D217E possibly damaging Het
Olfr1484 A G 19: 13,585,630 T109A probably benign Het
Olfr243 T C 7: 103,716,651 I19T probably damaging Het
Pde6c C A 19: 38,141,492 D283E probably damaging Het
Phldb2 A G 16: 45,770,779 probably benign Het
Pigt G C 2: 164,507,499 R574P probably damaging Het
Pkd1 T C 17: 24,577,526 I2354T possibly damaging Het
Prdm15 T C 16: 97,839,306 E27G probably damaging Het
Ptpn14 A G 1: 189,865,512 I1140V probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rfx7 T C 9: 72,611,789 S258P probably damaging Het
Rnf17 G T 14: 56,493,365 G1209C probably damaging Het
S1pr4 C T 10: 81,499,391 probably null Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpinb1b T A 13: 33,093,663 V293E possibly damaging Het
Serpinb9b T C 13: 33,038,129 probably null Het
Sez6l A C 5: 112,475,049 I212S probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag9 G A 11: 94,048,539 R98H probably damaging Het
St3gal5 T C 6: 72,142,288 L128P probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Stxbp5l A G 16: 37,208,111 V530A probably benign Het
Tatdn1 A G 15: 58,921,190 probably benign Het
Tbc1d8 A G 1: 39,391,125 S466P probably benign Het
Tmem199 A T 11: 78,508,326 M175K possibly damaging Het
Trmt12 A G 15: 58,872,915 E54G probably benign Het
Usp37 G T 1: 74,493,004 Q77K possibly damaging Het
Vezf1 A G 11: 88,076,299 I301V possibly damaging Het
Vmn1r34 T G 6: 66,636,948 M269L probably benign Het
Wdr93 C A 7: 79,771,509 probably null Het
Wnk2 T C 13: 49,060,894 D644G probably damaging Het
Zc3h13 C T 14: 75,337,483 R1591* probably null Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp180 T A 7: 24,104,624 V156D probably benign Het
Zfp646 G T 7: 127,880,187 probably null Het
Zscan12 C A 13: 21,366,643 T144K probably benign Het
Other mutations in Ankrd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ankrd44 APN 1 54662647 splice site probably benign
IGL00839:Ankrd44 APN 1 54667435 missense probably benign 0.27
IGL01145:Ankrd44 APN 1 54762259 critical splice donor site probably null
IGL01380:Ankrd44 APN 1 54727565 missense probably benign 0.00
IGL01415:Ankrd44 APN 1 54752928 missense probably damaging 1.00
IGL01958:Ankrd44 APN 1 54766966 missense probably damaging 0.99
IGL02014:Ankrd44 APN 1 54657620 missense possibly damaging 0.95
IGL02745:Ankrd44 APN 1 54766791 missense probably damaging 1.00
IGL03008:Ankrd44 APN 1 54766809 missense probably damaging 1.00
wilderness UTSW 1 54735034 synonymous silent
PIT4812001:Ankrd44 UTSW 1 54723038 nonsense probably null
R0416:Ankrd44 UTSW 1 54743339 missense possibly damaging 0.63
R0554:Ankrd44 UTSW 1 54763758 missense probably benign 0.00
R0575:Ankrd44 UTSW 1 54762310 missense probably damaging 1.00
R1323:Ankrd44 UTSW 1 54766450 splice site probably benign
R2032:Ankrd44 UTSW 1 54723009 splice site probably null
R4458:Ankrd44 UTSW 1 54762391 missense possibly damaging 0.92
R4610:Ankrd44 UTSW 1 54766748 intron probably benign
R4727:Ankrd44 UTSW 1 54667417 missense probably benign 0.05
R4780:Ankrd44 UTSW 1 54763757 missense probably benign 0.00
R4801:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4802:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4810:Ankrd44 UTSW 1 54735143 intron probably benign
R4961:Ankrd44 UTSW 1 54663912 missense probably damaging 1.00
R5053:Ankrd44 UTSW 1 54735089 nonsense probably null
R5093:Ankrd44 UTSW 1 54763718 missense probably damaging 1.00
R5155:Ankrd44 UTSW 1 54778330 missense probably benign 0.43
R5248:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R5306:Ankrd44 UTSW 1 54926203 utr 5 prime probably benign
R5595:Ankrd44 UTSW 1 54735050 missense probably damaging 1.00
R5595:Ankrd44 UTSW 1 54762347 missense probably damaging 1.00
R6288:Ankrd44 UTSW 1 54763763 missense probably damaging 1.00
R6332:Ankrd44 UTSW 1 54762273 missense probably damaging 1.00
R6453:Ankrd44 UTSW 1 54657704 splice site probably null
R6610:Ankrd44 UTSW 1 54655087 missense probably benign 0.02
R6699:Ankrd44 UTSW 1 54762445 missense probably damaging 1.00
R6905:Ankrd44 UTSW 1 54792494 missense probably damaging 1.00
Z1088:Ankrd44 UTSW 1 54658982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTCACTGAGATAGAGTTTGGGGC -3'
(R):5'- GGAACAAATATCCTTGTTGCTGTCTGC -3'

Sequencing Primer
(F):5'- aggtaagcactctcccctg -3'
(R):5'- GTTTCTTGGTTTTGCAGCCAC -3'
Posted On2014-04-24