Incidental Mutation 'R1605:Chd7'
ID176381
Institutional Source Beutler Lab
Gene Symbol Chd7
Ensembl Gene ENSMUSG00000041235
Gene Namechromodomain helicase DNA binding protein 7
SynonymsA730019I05Rik, Cycn, Cyn, Dz, Edy, Flo, GENA 47, Gena 52, GENA 60, Lda, Mt, Obt, Todo, WBE1, Whi
MMRRC Submission 039642-MU
Accession Numbers

Genbank: NM_001081417; MGI: 2444748

Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R1605 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location8690406-8867659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8844675 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1595 (E1595K)
Ref Sequence ENSEMBL: ENSMUSP00000059079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000170391]
Predicted Effect probably damaging
Transcript: ENSMUST00000039267
AA Change: E1595K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235
AA Change: E1595K

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051558
AA Change: E1595K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235
AA Change: E1595K

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
low complexity region 585 595 N/A INTRINSIC
low complexity region 632 696 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
low complexity region 735 748 N/A INTRINSIC
low complexity region 759 768 N/A INTRINSIC
CHROMO 789 854 2.54e-9 SMART
CHROMO 870 927 2.94e-5 SMART
low complexity region 928 939 N/A INTRINSIC
DEXDc 954 1155 9.64e-38 SMART
HELICc 1310 1394 1.67e-23 SMART
Blast:DEXDc 1608 1653 8e-16 BLAST
low complexity region 1728 1739 N/A INTRINSIC
internal_repeat_2 1774 1825 1.31e-5 PROSPERO
low complexity region 1831 1846 N/A INTRINSIC
low complexity region 1898 1906 N/A INTRINSIC
low complexity region 1929 1947 N/A INTRINSIC
SANT 1952 2011 9.31e-1 SMART
internal_repeat_2 2079 2126 1.31e-5 PROSPERO
low complexity region 2173 2195 N/A INTRINSIC
low complexity region 2218 2244 N/A INTRINSIC
low complexity region 2387 2407 N/A INTRINSIC
low complexity region 2437 2452 N/A INTRINSIC
BRK 2553 2602 6.57e-23 SMART
BRK 2631 2675 3.77e-23 SMART
low complexity region 2715 2725 N/A INTRINSIC
low complexity region 2746 2758 N/A INTRINSIC
low complexity region 2769 2778 N/A INTRINSIC
low complexity region 2785 2796 N/A INTRINSIC
low complexity region 2810 2821 N/A INTRINSIC
low complexity region 2897 2916 N/A INTRINSIC
low complexity region 2967 2980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130709
Predicted Effect probably benign
Transcript: ENSMUST00000170391
SMART Domains Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
low complexity region 48 59 N/A INTRINSIC
low complexity region 107 129 N/A INTRINSIC
low complexity region 152 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
low complexity region 512 535 N/A INTRINSIC
BRK 586 630 3.77e-23 SMART
low complexity region 670 680 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 724 733 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 765 776 N/A INTRINSIC
low complexity region 852 871 N/A INTRINSIC
low complexity region 922 935 N/A INTRINSIC
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik T A 7: 4,151,396 H131L probably benign Het
1700123L14Rik A G 6: 96,164,812 M417T probably benign Het
4931408C20Rik A T 1: 26,684,430 H556Q possibly damaging Het
5730409E04Rik A G 4: 126,612,311 K211E probably damaging Het
Acot7 A G 4: 152,206,828 I84V possibly damaging Het
Ankrd44 A G 1: 54,828,622 V34A probably benign Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Atr T A 9: 95,936,463 I2163K probably damaging Het
Azgp1 A T 5: 137,985,164 R34* probably null Het
Ccdc152 T G 15: 3,298,121 K58T probably damaging Het
Ccdc88b T A 19: 6,850,469 Q912L probably benign Het
Col11a1 G A 3: 114,131,641 G41D probably damaging Het
Cyp2b23 C T 7: 26,686,418 V5I probably benign Het
D430041D05Rik A G 2: 104,255,570 V22A possibly damaging Het
Ddi1 T C 9: 6,266,012 Y119C probably benign Het
Dysf T C 6: 84,106,941 L785P probably damaging Het
Eqtn T A 4: 94,928,350 T69S possibly damaging Het
F11 T A 8: 45,241,580 K581N probably damaging Het
Gli2 G A 1: 118,854,560 P172S probably damaging Het
Gm10093 A G 17: 78,492,108 D176G probably damaging Het
Gm7579 G T 7: 142,211,866 C3F unknown Het
Grin2a A G 16: 9,663,330 V501A possibly damaging Het
Grk4 G A 5: 34,674,557 D57N probably damaging Het
Gsdma A T 11: 98,666,493 D86V probably damaging Het
Gsx1 A G 5: 147,189,928 E187G probably damaging Het
Inpp5k T A 11: 75,633,481 F75L probably benign Het
Itpr1 T C 6: 108,349,659 V114A possibly damaging Het
Izumo3 A T 4: 92,144,740 C130S probably damaging Het
Mei4 G A 9: 81,927,586 E241K possibly damaging Het
Mocs2 T C 13: 114,824,584 V39A probably benign Het
Mroh2b G A 15: 4,945,090 R1184H probably benign Het
Msh3 T C 13: 92,300,275 Q509R probably null Het
Myh8 T C 11: 67,301,671 W1459R probably damaging Het
Mypop T A 7: 19,000,993 probably benign Het
Ndc1 C A 4: 107,368,096 T3K probably damaging Het
Nf1 A C 11: 79,440,923 M695L probably benign Het
Nutm2 C A 13: 50,469,919 D217E possibly damaging Het
Olfr1484 A G 19: 13,585,630 T109A probably benign Het
Olfr243 T C 7: 103,716,651 I19T probably damaging Het
Pde6c C A 19: 38,141,492 D283E probably damaging Het
Phldb2 A G 16: 45,770,779 probably benign Het
Pigt G C 2: 164,507,499 R574P probably damaging Het
Pkd1 T C 17: 24,577,526 I2354T possibly damaging Het
Prdm15 T C 16: 97,839,306 E27G probably damaging Het
Ptpn14 A G 1: 189,865,512 I1140V probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rfx7 T C 9: 72,611,789 S258P probably damaging Het
Rnf17 G T 14: 56,493,365 G1209C probably damaging Het
S1pr4 C T 10: 81,499,391 probably null Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpinb1b T A 13: 33,093,663 V293E possibly damaging Het
Serpinb9b T C 13: 33,038,129 probably null Het
Sez6l A C 5: 112,475,049 I212S probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag9 G A 11: 94,048,539 R98H probably damaging Het
St3gal5 T C 6: 72,142,288 L128P probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Stxbp5l A G 16: 37,208,111 V530A probably benign Het
Tatdn1 A G 15: 58,921,190 probably benign Het
Tbc1d8 A G 1: 39,391,125 S466P probably benign Het
Tmem199 A T 11: 78,508,326 M175K possibly damaging Het
Trmt12 A G 15: 58,872,915 E54G probably benign Het
Usp37 G T 1: 74,493,004 Q77K possibly damaging Het
Vezf1 A G 11: 88,076,299 I301V possibly damaging Het
Vmn1r34 T G 6: 66,636,948 M269L probably benign Het
Wdr93 C A 7: 79,771,509 probably null Het
Wnk2 T C 13: 49,060,894 D644G probably damaging Het
Zc3h13 C T 14: 75,337,483 R1591* probably null Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp180 T A 7: 24,104,624 V156D probably benign Het
Zfp646 G T 7: 127,880,187 probably null Het
Zscan12 C A 13: 21,366,643 T144K probably benign Het
Other mutations in Chd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Chd7 APN 4 8859106 missense probably damaging 1.00
IGL00510:Chd7 APN 4 8801404 missense probably damaging 1.00
IGL00741:Chd7 APN 4 8839454 missense probably damaging 1.00
IGL00796:Chd7 APN 4 8847271 missense possibly damaging 0.95
IGL00907:Chd7 APN 4 8840435 missense probably damaging 0.98
IGL00930:Chd7 APN 4 8805181 missense probably damaging 1.00
IGL01542:Chd7 APN 4 8859285 missense possibly damaging 0.71
IGL01602:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01605:Chd7 APN 4 8833834 missense probably damaging 1.00
IGL01670:Chd7 APN 4 8827033 missense probably damaging 0.98
IGL02434:Chd7 APN 4 8752145 missense probably benign 0.00
IGL02531:Chd7 APN 4 8854134 missense probably damaging 1.00
IGL02626:Chd7 APN 4 8826519 missense probably damaging 1.00
IGL02961:Chd7 APN 4 8751542 missense probably damaging 1.00
IGL02972:Chd7 APN 4 8855174 missense probably benign 0.30
IGL03329:Chd7 APN 4 8841108 missense probably damaging 1.00
Fili UTSW 4 8839523 missense probably damaging 1.00
D4043:Chd7 UTSW 4 8862650 missense probably damaging 1.00
IGL02991:Chd7 UTSW 4 8828398 missense possibly damaging 0.91
PIT4466001:Chd7 UTSW 4 8753101 missense unknown
PIT4472001:Chd7 UTSW 4 8753101 missense unknown
R0157:Chd7 UTSW 4 8833759 missense probably damaging 1.00
R0179:Chd7 UTSW 4 8862516 missense probably benign 0.22
R0240:Chd7 UTSW 4 8852670 unclassified probably benign
R0388:Chd7 UTSW 4 8854560 missense probably benign 0.27
R0462:Chd7 UTSW 4 8850821 missense probably damaging 1.00
R0512:Chd7 UTSW 4 8805139 intron probably benign
R0657:Chd7 UTSW 4 8753141 missense probably damaging 1.00
R0799:Chd7 UTSW 4 8801310 intron probably benign
R0885:Chd7 UTSW 4 8866432 missense probably damaging 1.00
R1056:Chd7 UTSW 4 8822402 missense possibly damaging 0.50
R1086:Chd7 UTSW 4 8866458 missense probably benign 0.04
R1353:Chd7 UTSW 4 8839556 missense probably damaging 0.99
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1466:Chd7 UTSW 4 8840561 splice site probably null
R1693:Chd7 UTSW 4 8864307 critical splice donor site probably null
R1695:Chd7 UTSW 4 8833960 missense probably damaging 1.00
R1938:Chd7 UTSW 4 8847200 missense probably damaging 1.00
R1964:Chd7 UTSW 4 8865978 missense probably damaging 0.96
R2020:Chd7 UTSW 4 8855226 missense probably benign 0.00
R2134:Chd7 UTSW 4 8753147 missense probably damaging 0.99
R2171:Chd7 UTSW 4 8752424 missense probably damaging 1.00
R2271:Chd7 UTSW 4 8785532 missense probably damaging 1.00
R2300:Chd7 UTSW 4 8855241 missense probably benign 0.02
R2355:Chd7 UTSW 4 8801350 missense possibly damaging 0.95
R3153:Chd7 UTSW 4 8855174 missense probably benign 0.30
R3430:Chd7 UTSW 4 8844517 missense probably damaging 0.99
R3746:Chd7 UTSW 4 8752537 missense probably damaging 1.00
R4118:Chd7 UTSW 4 8865831 missense probably damaging 1.00
R4119:Chd7 UTSW 4 8785658 intron probably benign
R4332:Chd7 UTSW 4 8854143 missense probably damaging 1.00
R4402:Chd7 UTSW 4 8866353 missense possibly damaging 0.61
R4571:Chd7 UTSW 4 8866217 missense probably benign 0.09
R4722:Chd7 UTSW 4 8822445 missense probably damaging 1.00
R4821:Chd7 UTSW 4 8844706 missense probably damaging 1.00
R4894:Chd7 UTSW 4 8838629 missense probably damaging 0.99
R5205:Chd7 UTSW 4 8752509 missense possibly damaging 0.60
R5344:Chd7 UTSW 4 8844417 missense probably damaging 1.00
R5484:Chd7 UTSW 4 8828258 missense probably damaging 1.00
R5578:Chd7 UTSW 4 8847149 missense probably benign 0.09
R5583:Chd7 UTSW 4 8752473 missense probably damaging 1.00
R5888:Chd7 UTSW 4 8866382 missense probably damaging 0.98
R5905:Chd7 UTSW 4 8840553 missense possibly damaging 0.91
R6091:Chd7 UTSW 4 8751875 missense probably damaging 0.99
R6126:Chd7 UTSW 4 8826482 missense probably damaging 1.00
R6399:Chd7 UTSW 4 8828274 missense probably damaging 1.00
R6751:Chd7 UTSW 4 8833866 missense probably damaging 1.00
R6810:Chd7 UTSW 4 8839523 missense probably damaging 1.00
R6868:Chd7 UTSW 4 8811501 splice site probably null
R6952:Chd7 UTSW 4 8856797 missense probably damaging 1.00
R6986:Chd7 UTSW 4 8859285 missense possibly damaging 0.71
R6990:Chd7 UTSW 4 8844525 missense probably benign 0.28
R7139:Chd7 UTSW 4 8865865 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAGACTGCTGCCTAATCTGACC -3'
(R):5'- TCGACTTTACGAGCCACAACCTGC -3'

Sequencing Primer
(F):5'- AAGGTTGGTATGACGCTCACC -3'
(R):5'- TGCAGAAAGTTAGTGCGGAG -3'
Posted On2014-04-24