Incidental Mutation 'R1606:Ucp1'
ID 176486
Institutional Source Beutler Lab
Gene Symbol Ucp1
Ensembl Gene ENSMUSG00000031710
Gene Name uncoupling protein 1 (mitochondrial, proton carrier)
Synonyms Slc25a7
MMRRC Submission 039643-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1606 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 84016981-84025081 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 84021933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 255 (A255E)
Ref Sequence ENSEMBL: ENSMUSP00000034146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034146]
AlphaFold P12242
Predicted Effect probably damaging
Transcript: ENSMUST00000034146
AA Change: A255E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034146
Gene: ENSMUSG00000031710
AA Change: A255E

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 5.7e-20 PFAM
Pfam:Mito_carr 109 206 3.3e-20 PFAM
Pfam:Mito_carr 209 300 1.6e-18 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit impaired thermoregulation on some genetic backgrounds. Biochemical alterations in brown fat mitochondria are also observed. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Spontaneous(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A G 19: 43,825,091 (GRCm39) D1459G probably damaging Het
Adhfe1 G A 1: 9,623,698 (GRCm39) probably null Het
Adsl C T 15: 80,836,425 (GRCm39) Q61* probably null Het
Arhgap26 T A 18: 39,429,925 (GRCm39) C214S probably damaging Het
Armc8 A T 9: 99,419,782 (GRCm39) N9K probably damaging Het
Asxl1 A G 2: 153,242,375 (GRCm39) D975G probably damaging Het
Atp8b3 T C 10: 80,368,412 (GRCm39) E187G probably damaging Het
Bltp1 G A 3: 36,996,548 (GRCm39) D1087N probably damaging Het
Cdcp2 T C 4: 106,959,710 (GRCm39) S42P probably damaging Het
Chek1 A G 9: 36,630,820 (GRCm39) L198P probably damaging Het
Dlc1 A G 8: 37,317,406 (GRCm39) V423A probably benign Het
Dpy19l2 A G 9: 24,492,511 (GRCm39) S696P probably benign Het
Echdc3 A T 2: 6,200,438 (GRCm39) C183S possibly damaging Het
Exph5 A C 9: 53,285,595 (GRCm39) D892A probably benign Het
Fam120b T A 17: 15,622,073 (GRCm39) I17K possibly damaging Het
Fbln5 C T 12: 101,731,457 (GRCm39) D246N probably benign Het
Fbxo15 A C 18: 84,980,745 (GRCm39) K195T possibly damaging Het
Fzd1 C A 5: 4,807,514 (GRCm39) E23* probably null Het
Gas2l1 C A 11: 5,014,434 (GRCm39) A9S probably damaging Het
Gcc2 C T 10: 58,105,270 (GRCm39) L69F probably damaging Het
Ggt6 C T 11: 72,328,559 (GRCm39) A353V possibly damaging Het
Gphn T A 12: 78,730,657 (GRCm39) V764E probably damaging Het
Grid1 A T 14: 35,167,922 (GRCm39) Y482F probably damaging Het
Hlx G T 1: 184,464,184 (GRCm39) A52D probably damaging Het
Ifit1bl1 C T 19: 34,571,444 (GRCm39) V338M probably benign Het
Klhl14 T A 18: 21,698,589 (GRCm39) Q408L possibly damaging Het
Lacc1 T A 14: 77,267,081 (GRCm39) Q394L probably benign Het
Lcor T G 19: 41,573,513 (GRCm39) M756R probably benign Het
Lipe A G 7: 25,087,569 (GRCm39) F477L probably damaging Het
Lrig2 A G 3: 104,387,423 (GRCm39) probably null Het
Megf8 T A 7: 25,058,120 (GRCm39) H2131Q probably damaging Het
Nek1 A G 8: 61,577,310 (GRCm39) D1097G possibly damaging Het
Nhlrc3 A T 3: 53,366,078 (GRCm39) Y138* probably null Het
Nudcd2 T A 11: 40,626,834 (GRCm39) probably null Het
Numb T C 12: 83,847,784 (GRCm39) probably null Het
Or7h8 T G 9: 20,124,242 (GRCm39) L199R probably benign Het
Pacrg G A 17: 11,058,725 (GRCm39) Q11* probably null Het
Ppp1r37 A T 7: 19,268,924 (GRCm39) M192K probably damaging Het
Prmt8 T A 6: 127,666,799 (GRCm39) K392* probably null Het
Rab28 A T 5: 41,855,795 (GRCm39) W67R probably damaging Het
Rad21l C T 2: 151,496,606 (GRCm39) C365Y probably damaging Het
Rbm17 A T 2: 11,600,208 (GRCm39) F147I probably benign Het
Rbm46 A C 3: 82,771,848 (GRCm39) F256V probably damaging Het
Rcc1 A T 4: 132,062,087 (GRCm39) probably null Het
Rnf217 G T 10: 31,410,807 (GRCm39) T296N possibly damaging Het
Rnmt A G 18: 68,444,724 (GRCm39) D231G possibly damaging Het
Rph3al C T 11: 75,797,367 (GRCm39) V110I probably damaging Het
Rxfp2 T C 5: 149,983,362 (GRCm39) M289T probably benign Het
Sash1 T C 10: 8,605,721 (GRCm39) R890G probably benign Het
Sf3b2 A T 19: 5,338,026 (GRCm39) D245E probably benign Het
Skint9 A T 4: 112,246,398 (GRCm39) V238E probably benign Het
Slc26a8 T A 17: 28,857,455 (GRCm39) D896V possibly damaging Het
Slc35b4 T A 6: 34,135,323 (GRCm39) K330* probably null Het
Slco1a4 G T 6: 141,785,337 (GRCm39) H84Q probably damaging Het
Sptbn2 G T 19: 4,800,270 (GRCm39) probably null Het
St6galnac3 A T 3: 152,912,305 (GRCm39) D227E probably benign Het
Tek G A 4: 94,738,004 (GRCm39) D685N probably damaging Het
Trf G T 9: 103,102,335 (GRCm39) probably null Het
Trpm5 T A 7: 142,638,908 (GRCm39) K288* probably null Het
Ttn C T 2: 76,567,356 (GRCm39) V27846I probably damaging Het
Tyr A T 7: 87,087,179 (GRCm39) D444E probably benign Het
Ush2a A G 1: 188,491,963 (GRCm39) D3084G probably benign Het
Yeats4 T C 10: 117,053,344 (GRCm39) Y139C probably damaging Het
Zbtb6 A G 2: 37,319,130 (GRCm39) V266A probably benign Het
Zfp784 A T 7: 5,038,774 (GRCm39) N261K possibly damaging Het
Other mutations in Ucp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4585001:Ucp1 UTSW 8 84,020,577 (GRCm39) missense probably damaging 1.00
R0050:Ucp1 UTSW 8 84,020,857 (GRCm39) missense probably damaging 1.00
R0055:Ucp1 UTSW 8 84,017,233 (GRCm39) nonsense probably null
R0055:Ucp1 UTSW 8 84,017,233 (GRCm39) nonsense probably null
R0505:Ucp1 UTSW 8 84,021,936 (GRCm39) missense possibly damaging 0.78
R0590:Ucp1 UTSW 8 84,018,232 (GRCm39) splice site probably benign
R0681:Ucp1 UTSW 8 84,021,936 (GRCm39) missense possibly damaging 0.78
R0731:Ucp1 UTSW 8 84,024,476 (GRCm39) splice site probably benign
R1722:Ucp1 UTSW 8 84,017,317 (GRCm39) missense probably benign 0.25
R1809:Ucp1 UTSW 8 84,024,496 (GRCm39) missense probably damaging 0.99
R1823:Ucp1 UTSW 8 84,020,661 (GRCm39) missense probably damaging 1.00
R3809:Ucp1 UTSW 8 84,017,270 (GRCm39) missense probably damaging 0.99
R4085:Ucp1 UTSW 8 84,020,580 (GRCm39) missense probably benign 0.43
R4673:Ucp1 UTSW 8 84,021,876 (GRCm39) missense probably damaging 1.00
R4998:Ucp1 UTSW 8 84,024,484 (GRCm39) critical splice acceptor site probably null
R5163:Ucp1 UTSW 8 84,020,832 (GRCm39) missense possibly damaging 0.95
R5421:Ucp1 UTSW 8 84,017,320 (GRCm39) missense probably benign 0.12
R5790:Ucp1 UTSW 8 84,024,520 (GRCm39) missense possibly damaging 0.54
R5994:Ucp1 UTSW 8 84,020,567 (GRCm39) missense possibly damaging 0.92
R6574:Ucp1 UTSW 8 84,020,718 (GRCm39) critical splice donor site probably null
R6732:Ucp1 UTSW 8 84,018,106 (GRCm39) missense probably benign 0.08
R7282:Ucp1 UTSW 8 84,020,531 (GRCm39) missense probably benign 0.03
R7343:Ucp1 UTSW 8 84,021,881 (GRCm39) missense probably damaging 0.99
R7878:Ucp1 UTSW 8 84,024,521 (GRCm39) missense probably benign 0.19
R8008:Ucp1 UTSW 8 84,020,640 (GRCm39) missense probably benign 0.32
R8365:Ucp1 UTSW 8 84,020,628 (GRCm39) missense probably damaging 0.97
R8899:Ucp1 UTSW 8 84,017,216 (GRCm39) missense probably benign 0.35
R9186:Ucp1 UTSW 8 84,017,272 (GRCm39) nonsense probably null
R9499:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
R9551:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
R9552:Ucp1 UTSW 8 84,024,509 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACATACAGCTCAAAGTCTGGTG -3'
(R):5'- GGTTTCCAATGCAATACAGCAGCAC -3'

Sequencing Primer
(F):5'- CAAAGTCTGGTGTTGCTCAC -3'
(R):5'- agtcccctcaagtgctacc -3'
Posted On 2014-04-24