Incidental Mutation 'R1606:Atp8b3'
ID176498
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene NameATPase, class I, type 8B, member 3
Synonyms1700042F02Rik, SAPLT, 1700056N23Rik
MMRRC Submission 039643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R1606 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80519584-80539124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80532578 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 187 (E187G)
Ref Sequence ENSEMBL: ENSMUSP00000151571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000219648] [ENSMUST00000220326]
Predicted Effect probably damaging
Transcript: ENSMUST00000020383
AA Change: E187G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: E187G

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219648
Predicted Effect probably damaging
Transcript: ENSMUST00000220326
AA Change: E187G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,942,399 D1087N probably damaging Het
Abcc2 A G 19: 43,836,652 D1459G probably damaging Het
Adhfe1 G A 1: 9,553,473 probably null Het
Adsl C T 15: 80,952,224 Q61* probably null Het
Arhgap26 T A 18: 39,296,872 C214S probably damaging Het
Armc8 A T 9: 99,537,729 N9K probably damaging Het
Asxl1 A G 2: 153,400,455 D975G probably damaging Het
Cdcp2 T C 4: 107,102,513 S42P probably damaging Het
Chek1 A G 9: 36,719,524 L198P probably damaging Het
Dlc1 A G 8: 36,850,252 V423A probably benign Het
Dpy19l2 A G 9: 24,581,215 S696P probably benign Het
Echdc3 A T 2: 6,195,627 C183S possibly damaging Het
Exph5 A C 9: 53,374,295 D892A probably benign Het
Fam120b T A 17: 15,401,811 I17K possibly damaging Het
Fbln5 C T 12: 101,765,198 D246N probably benign Het
Fbxo15 A C 18: 84,962,620 K195T possibly damaging Het
Fzd1 C A 5: 4,757,514 E23* probably null Het
Gas2l1 C A 11: 5,064,434 A9S probably damaging Het
Gcc2 C T 10: 58,269,448 L69F probably damaging Het
Ggt6 C T 11: 72,437,733 A353V possibly damaging Het
Gm340 T G 19: 41,585,074 M756R probably benign Het
Gphn T A 12: 78,683,883 V764E probably damaging Het
Grid1 A T 14: 35,445,965 Y482F probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifit1bl1 C T 19: 34,594,044 V338M probably benign Het
Klhl14 T A 18: 21,565,532 Q408L possibly damaging Het
Lacc1 T A 14: 77,029,641 Q394L probably benign Het
Lipe A G 7: 25,388,144 F477L probably damaging Het
Lrig2 A G 3: 104,480,107 probably null Het
Megf8 T A 7: 25,358,695 H2131Q probably damaging Het
Nek1 A G 8: 61,124,276 D1097G possibly damaging Het
Nhlrc3 A T 3: 53,458,657 Y138* probably null Het
Nudcd2 T A 11: 40,736,007 probably null Het
Numb T C 12: 83,801,010 probably null Het
Olfr871 T G 9: 20,212,946 L199R probably benign Het
Pacrg G A 17: 10,839,838 Q11* probably null Het
Ppp1r37 A T 7: 19,534,999 M192K probably damaging Het
Prmt8 T A 6: 127,689,836 K392* probably null Het
Rab28 A T 5: 41,698,452 W67R probably damaging Het
Rad21l C T 2: 151,654,686 C365Y probably damaging Het
Rbm17 A T 2: 11,595,397 F147I probably benign Het
Rbm46 A C 3: 82,864,541 F256V probably damaging Het
Rcc1 A T 4: 132,334,776 probably null Het
Rnf217 G T 10: 31,534,811 T296N possibly damaging Het
Rnmt A G 18: 68,311,653 D231G possibly damaging Het
Rph3al C T 11: 75,906,541 V110I probably damaging Het
Rxfp2 T C 5: 150,059,897 M289T probably benign Het
Sash1 T C 10: 8,729,957 R890G probably benign Het
Sf3b2 A T 19: 5,287,998 D245E probably benign Het
Skint9 A T 4: 112,389,201 V238E probably benign Het
Slc26a8 T A 17: 28,638,481 D896V possibly damaging Het
Slc35b4 T A 6: 34,158,388 K330* probably null Het
Slco1a4 G T 6: 141,839,611 H84Q probably damaging Het
Sptbn2 G T 19: 4,750,242 probably null Het
St6galnac3 A T 3: 153,206,668 D227E probably benign Het
Tek G A 4: 94,849,767 D685N probably damaging Het
Trf G T 9: 103,225,136 probably null Het
Trpm5 T A 7: 143,085,171 K288* probably null Het
Ttn C T 2: 76,737,012 V27846I probably damaging Het
Tyr A T 7: 87,437,971 D444E probably benign Het
Ucp1 C A 8: 83,295,304 A255E probably damaging Het
Ush2a A G 1: 188,759,766 D3084G probably benign Het
Yeats4 T C 10: 117,217,439 Y139C probably damaging Het
Zbtb6 A G 2: 37,429,118 V266A probably benign Het
Zfp784 A T 7: 5,035,775 N261K possibly damaging Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80530987 missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80526164 splice site probably benign
IGL00904:Atp8b3 APN 10 80528764 missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80524376 missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80534229 splice site probably benign
IGL01448:Atp8b3 APN 10 80520422 missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80530968 nonsense probably null
IGL01754:Atp8b3 APN 10 80530961 splice site probably null
IGL01809:Atp8b3 APN 10 80520011 missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80521828 missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80527233 splice site probably benign
IGL02224:Atp8b3 APN 10 80525976 splice site probably benign
IGL02377:Atp8b3 APN 10 80520294 missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80530628 missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80530604 missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80534458 missense probably damaging 1.00
R0277:Atp8b3 UTSW 10 80526909 missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80520084 missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80534198 missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80531018 missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80520183 missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80532542 missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80525785 missense probably benign 0.06
R1707:Atp8b3 UTSW 10 80521801 unclassified probably null
R1717:Atp8b3 UTSW 10 80528797 missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80530078 missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80525386 nonsense probably null
R2138:Atp8b3 UTSW 10 80527105 missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80530988 missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80526894 missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80534183 missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80519912 missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80526180 missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80529706 missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80523847 missense probably benign
R4518:Atp8b3 UTSW 10 80523847 missense probably benign
R4519:Atp8b3 UTSW 10 80523847 missense probably benign
R4619:Atp8b3 UTSW 10 80526024 missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80525623 missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80536770 unclassified probably null
R4774:Atp8b3 UTSW 10 80536322 missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80524354 missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80521842 missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80529699 missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80520173 missense probably benign
R5990:Atp8b3 UTSW 10 80525697 missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80529681 missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80520323 unclassified probably null
R6748:Atp8b3 UTSW 10 80525224 missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80526061 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TGTCACAGACTGGCAGAGGACTTAC -3'
(R):5'- GGAAACACAGCTTCTTACCTCAGGG -3'

Sequencing Primer
(F):5'- TGGCAGAGGACTTACCCTGAG -3'
(R):5'- tgtaagtacactgtagctgtcttc -3'
Posted On2014-04-24