Incidental Mutation 'R1606:Klhl14'
ID176515
Institutional Source Beutler Lab
Gene Symbol Klhl14
Ensembl Gene ENSMUSG00000042514
Gene Namekelch-like 14
Synonymsprintor, 6330403N15Rik
MMRRC Submission 039643-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R1606 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location21550377-21654718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21565532 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 408 (Q408L)
Ref Sequence ENSEMBL: ENSMUSP00000113755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049105] [ENSMUST00000122333]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049105
AA Change: Q408L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042015
Gene: ENSMUSG00000042514
AA Change: Q408L

DomainStartEndE-ValueType
BTB 33 183 6.57e-25 SMART
BACK 191 281 2.61e-9 SMART
Kelch 325 374 1.63e-1 SMART
Kelch 375 426 3.66e-2 SMART
Kelch 427 473 5.05e-14 SMART
Kelch 474 520 1.79e-5 SMART
Kelch 521 572 3.06e-4 SMART
Kelch 573 622 5.29e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122333
AA Change: Q408L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113755
Gene: ENSMUSG00000042514
AA Change: Q408L

DomainStartEndE-ValueType
BTB 33 183 6.57e-25 SMART
BACK 191 281 2.61e-9 SMART
Kelch 325 374 1.63e-1 SMART
Kelch 375 426 3.66e-2 SMART
Kelch 427 473 5.05e-14 SMART
Kelch 474 520 1.79e-5 SMART
Kelch 521 572 3.06e-4 SMART
Kelch 573 622 5.29e-1 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kelch-like gene family, whose members contain a BTB/POZ domain, a BACK domain, and several Kelch domains. The encoded protein possesses six Kelch domains and localizes to the endoplasmic reticulum, where it interacts with torsin-1A. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,942,399 D1087N probably damaging Het
Abcc2 A G 19: 43,836,652 D1459G probably damaging Het
Adhfe1 G A 1: 9,553,473 probably null Het
Adsl C T 15: 80,952,224 Q61* probably null Het
Arhgap26 T A 18: 39,296,872 C214S probably damaging Het
Armc8 A T 9: 99,537,729 N9K probably damaging Het
Asxl1 A G 2: 153,400,455 D975G probably damaging Het
Atp8b3 T C 10: 80,532,578 E187G probably damaging Het
Cdcp2 T C 4: 107,102,513 S42P probably damaging Het
Chek1 A G 9: 36,719,524 L198P probably damaging Het
Dlc1 A G 8: 36,850,252 V423A probably benign Het
Dpy19l2 A G 9: 24,581,215 S696P probably benign Het
Echdc3 A T 2: 6,195,627 C183S possibly damaging Het
Exph5 A C 9: 53,374,295 D892A probably benign Het
Fam120b T A 17: 15,401,811 I17K possibly damaging Het
Fbln5 C T 12: 101,765,198 D246N probably benign Het
Fbxo15 A C 18: 84,962,620 K195T possibly damaging Het
Fzd1 C A 5: 4,757,514 E23* probably null Het
Gas2l1 C A 11: 5,064,434 A9S probably damaging Het
Gcc2 C T 10: 58,269,448 L69F probably damaging Het
Ggt6 C T 11: 72,437,733 A353V possibly damaging Het
Gm340 T G 19: 41,585,074 M756R probably benign Het
Gphn T A 12: 78,683,883 V764E probably damaging Het
Grid1 A T 14: 35,445,965 Y482F probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifit1bl1 C T 19: 34,594,044 V338M probably benign Het
Lacc1 T A 14: 77,029,641 Q394L probably benign Het
Lipe A G 7: 25,388,144 F477L probably damaging Het
Lrig2 A G 3: 104,480,107 probably null Het
Megf8 T A 7: 25,358,695 H2131Q probably damaging Het
Nek1 A G 8: 61,124,276 D1097G possibly damaging Het
Nhlrc3 A T 3: 53,458,657 Y138* probably null Het
Nudcd2 T A 11: 40,736,007 probably null Het
Numb T C 12: 83,801,010 probably null Het
Olfr871 T G 9: 20,212,946 L199R probably benign Het
Pacrg G A 17: 10,839,838 Q11* probably null Het
Ppp1r37 A T 7: 19,534,999 M192K probably damaging Het
Prmt8 T A 6: 127,689,836 K392* probably null Het
Rab28 A T 5: 41,698,452 W67R probably damaging Het
Rad21l C T 2: 151,654,686 C365Y probably damaging Het
Rbm17 A T 2: 11,595,397 F147I probably benign Het
Rbm46 A C 3: 82,864,541 F256V probably damaging Het
Rcc1 A T 4: 132,334,776 probably null Het
Rnf217 G T 10: 31,534,811 T296N possibly damaging Het
Rnmt A G 18: 68,311,653 D231G possibly damaging Het
Rph3al C T 11: 75,906,541 V110I probably damaging Het
Rxfp2 T C 5: 150,059,897 M289T probably benign Het
Sash1 T C 10: 8,729,957 R890G probably benign Het
Sf3b2 A T 19: 5,287,998 D245E probably benign Het
Skint9 A T 4: 112,389,201 V238E probably benign Het
Slc26a8 T A 17: 28,638,481 D896V possibly damaging Het
Slc35b4 T A 6: 34,158,388 K330* probably null Het
Slco1a4 G T 6: 141,839,611 H84Q probably damaging Het
Sptbn2 G T 19: 4,750,242 probably null Het
St6galnac3 A T 3: 153,206,668 D227E probably benign Het
Tek G A 4: 94,849,767 D685N probably damaging Het
Trf G T 9: 103,225,136 probably null Het
Trpm5 T A 7: 143,085,171 K288* probably null Het
Ttn C T 2: 76,737,012 V27846I probably damaging Het
Tyr A T 7: 87,437,971 D444E probably benign Het
Ucp1 C A 8: 83,295,304 A255E probably damaging Het
Ush2a A G 1: 188,759,766 D3084G probably benign Het
Yeats4 T C 10: 117,217,439 Y139C probably damaging Het
Zbtb6 A G 2: 37,429,118 V266A probably benign Het
Zfp784 A T 7: 5,035,775 N261K possibly damaging Het
Other mutations in Klhl14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Klhl14 APN 18 21651864 missense probably benign 0.00
IGL01474:Klhl14 APN 18 21557854 missense probably damaging 0.99
IGL02005:Klhl14 APN 18 21624611 nonsense probably null
IGL02108:Klhl14 APN 18 21557920 missense probably damaging 0.98
IGL02371:Klhl14 APN 18 21652181 missense probably damaging 1.00
IGL03354:Klhl14 APN 18 21651728 missense probably damaging 1.00
P0027:Klhl14 UTSW 18 21558135 missense probably damaging 1.00
R0288:Klhl14 UTSW 18 21565563 missense probably damaging 1.00
R1419:Klhl14 UTSW 18 21652193 missense probably damaging 0.99
R1771:Klhl14 UTSW 18 21651620 missense probably damaging 0.97
R1928:Klhl14 UTSW 18 21651786 missense probably damaging 1.00
R1966:Klhl14 UTSW 18 21554673 missense probably damaging 1.00
R3624:Klhl14 UTSW 18 21557896 missense probably damaging 1.00
R4541:Klhl14 UTSW 18 21554639 nonsense probably null
R4664:Klhl14 UTSW 18 21554708 missense probably benign 0.06
R4856:Klhl14 UTSW 18 21557972 intron probably null
R4886:Klhl14 UTSW 18 21557972 intron probably null
R4893:Klhl14 UTSW 18 21557935 missense probably damaging 1.00
R5393:Klhl14 UTSW 18 21651994 missense probably benign 0.30
R5757:Klhl14 UTSW 18 21554734 missense probably damaging 1.00
R5951:Klhl14 UTSW 18 21651620 missense probably damaging 0.97
R5958:Klhl14 UTSW 18 21565535 missense probably damaging 0.99
T0722:Klhl14 UTSW 18 21558135 missense probably damaging 1.00
X0026:Klhl14 UTSW 18 21651941 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGTCAGCAACCTAACGGGTAAGC -3'
(R):5'- CTCTACCACAGTCTGGTTTTGGGTC -3'

Sequencing Primer
(F):5'- CCAAGGGTAGAACTTTGCCTC -3'
(R):5'- CCTTGCTACAGGGTTCCTGAG -3'
Posted On2014-04-24