Incidental Mutation 'R1608:Trpm8'
ID176598
Institutional Source Beutler Lab
Gene Symbol Trpm8
Ensembl Gene ENSMUSG00000036251
Gene Nametransient receptor potential cation channel, subfamily M, member 8
SynonymsCMR1, Trp-p8, TRPP8
MMRRC Submission 039645-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R1608 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location88277661-88389293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88326432 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 126 (S126A)
Ref Sequence ENSEMBL: ENSMUSP00000131209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040210] [ENSMUST00000113114] [ENSMUST00000171176]
Predicted Effect probably benign
Transcript: ENSMUST00000040210
AA Change: S126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036991
Gene: ENSMUSG00000036251
AA Change: S126A

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
Pfam:Ion_trans 769 979 4.7e-10 PFAM
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113114
AA Change: S126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108739
Gene: ENSMUSG00000036251
AA Change: S126A

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
Pfam:Ion_trans 769 979 4.7e-10 PFAM
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171176
AA Change: S126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131209
Gene: ENSMUSG00000036251
AA Change: S126A

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
transmembrane domain 763 780 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 825 847 N/A INTRINSIC
transmembrane domain 867 889 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to cold and reduced response to cold stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Trpm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Trpm8 APN 1 88379827 missense possibly damaging 0.82
IGL01387:Trpm8 APN 1 88343287 missense probably damaging 1.00
IGL01933:Trpm8 APN 1 88326405 missense probably damaging 0.98
IGL02075:Trpm8 APN 1 88325488 missense probably damaging 1.00
IGL02184:Trpm8 APN 1 88330694 critical splice acceptor site probably null
IGL02342:Trpm8 APN 1 88328250 missense possibly damaging 0.58
IGL02416:Trpm8 APN 1 88360716 missense probably damaging 1.00
IGL02696:Trpm8 APN 1 88348051 missense probably damaging 1.00
IGL02807:Trpm8 APN 1 88348108 missense probably damaging 1.00
R0078:Trpm8 UTSW 1 88328148 splice site probably benign
R1183:Trpm8 UTSW 1 88348091 missense probably damaging 1.00
R1713:Trpm8 UTSW 1 88365080 missense probably damaging 1.00
R1724:Trpm8 UTSW 1 88350856 missense possibly damaging 0.86
R1966:Trpm8 UTSW 1 88332748 splice site probably null
R2089:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2091:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2091:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2384:Trpm8 UTSW 1 88359656 missense probably benign 0.00
R2475:Trpm8 UTSW 1 88354449 missense probably damaging 1.00
R3726:Trpm8 UTSW 1 88328196 missense probably benign 0.00
R3745:Trpm8 UTSW 1 88348327 missense probably benign 0.21
R4063:Trpm8 UTSW 1 88362005 missense probably damaging 1.00
R4678:Trpm8 UTSW 1 88337129 missense probably benign 0.07
R4681:Trpm8 UTSW 1 88384705 missense possibly damaging 0.63
R5031:Trpm8 UTSW 1 88348188 missense probably benign 0.00
R5620:Trpm8 UTSW 1 88359651 critical splice acceptor site probably null
R5644:Trpm8 UTSW 1 88359739 missense possibly damaging 0.54
R5734:Trpm8 UTSW 1 88355280 missense probably benign 0.01
R5839:Trpm8 UTSW 1 88325506 missense possibly damaging 0.57
R5844:Trpm8 UTSW 1 88384711 makesense probably null
R5845:Trpm8 UTSW 1 88328180 missense probably benign 0.00
R5926:Trpm8 UTSW 1 88330747 missense probably damaging 0.99
R5940:Trpm8 UTSW 1 88351415 nonsense probably null
R6031:Trpm8 UTSW 1 88354469 missense possibly damaging 0.95
R6031:Trpm8 UTSW 1 88354469 missense possibly damaging 0.95
R6088:Trpm8 UTSW 1 88306678 start gained probably benign
R6283:Trpm8 UTSW 1 88348332 missense probably benign 0.09
R6299:Trpm8 UTSW 1 88354479 missense probably damaging 1.00
R6367:Trpm8 UTSW 1 88359683 missense probably damaging 1.00
R6526:Trpm8 UTSW 1 88361998 missense probably damaging 0.98
R6682:Trpm8 UTSW 1 88326502 missense probably damaging 0.96
R6751:Trpm8 UTSW 1 88384706 missense possibly damaging 0.63
R7057:Trpm8 UTSW 1 88362080 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- TTGTGGCACCATTCAGGATTGCCC -3'
(R):5'- CAAGATGCAGTGCAGAATGACCCC -3'

Sequencing Primer
(F):5'- ATTCAGGATTGCCCTCCCC -3'
(R):5'- TGCGTGGCTTCAAAGCAA -3'
Posted On2014-04-24