Incidental Mutation 'R1608:Gata3'
ID176600
Institutional Source Beutler Lab
Gene Symbol Gata3
Ensembl Gene ENSMUSG00000015619
Gene NameGATA binding protein 3
SynonymsGata-3, jal
MMRRC Submission 039645-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1608 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location9857078-9890034 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 9874768 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 97 (Y97*)
Ref Sequence ENSEMBL: ENSMUSP00000119730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102976] [ENSMUST00000130615]
Predicted Effect probably null
Transcript: ENSMUST00000102976
AA Change: Y132*
SMART Domains Protein: ENSMUSP00000100041
Gene: ENSMUSG00000015619
AA Change: Y132*

DomainStartEndE-ValueType
low complexity region 128 149 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
ZnF_GATA 257 307 3.65e-20 SMART
ZnF_GATA 311 361 2.9e-23 SMART
low complexity region 367 377 N/A INTRINSIC
low complexity region 399 425 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000130615
AA Change: Y97*
SMART Domains Protein: ENSMUSP00000119730
Gene: ENSMUSG00000015619
AA Change: Y97*

DomainStartEndE-ValueType
low complexity region 93 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153509
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the GATA family of transcription factors. The protein contains two GATA-type zinc fingers and is an important regulator of T-cell development and plays an important role in endothelial cell biology. Defects in this gene are the cause of hypoparathyroidism with sensorineural deafness and renal dysplasia. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous inactivation is embryonic lethal and show a variety of embryonic defects. T cell development is impaired when the locus is conditionally. Mice with a spontaneous mutation exhibit partial hair loss and various defects in hair structure and in hair growth cycle regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Gata3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Gata3 APN 2 9877465 missense probably damaging 1.00
IGL03168:Gata3 APN 2 9868814 missense probably damaging 1.00
R0054:Gata3 UTSW 2 9858447 missense probably damaging 1.00
R0123:Gata3 UTSW 2 9874809 missense probably benign 0.11
R0225:Gata3 UTSW 2 9874809 missense probably benign 0.11
R0724:Gata3 UTSW 2 9874575 missense probably benign
R1491:Gata3 UTSW 2 9877390 missense probably damaging 0.96
R1576:Gata3 UTSW 2 9863196 missense probably damaging 0.98
R1667:Gata3 UTSW 2 9877549 missense possibly damaging 0.95
R3119:Gata3 UTSW 2 9877585 critical splice acceptor site probably null
R3753:Gata3 UTSW 2 9868840 missense probably benign 0.39
R3876:Gata3 UTSW 2 9863143 missense probably damaging 1.00
R5040:Gata3 UTSW 2 9858515 missense probably damaging 1.00
R5292:Gata3 UTSW 2 9868874 missense probably damaging 1.00
R6414:Gata3 UTSW 2 9858434 missense possibly damaging 0.95
R6696:Gata3 UTSW 2 9874492 nonsense probably null
R6848:Gata3 UTSW 2 9858528 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCTGCACCTGATACTTGAGGCAC -3'
(R):5'- AGGACTGGGCCTTTCGTCTTAGAG -3'

Sequencing Primer
(F):5'- ACCTGATACTTGAGGCACTCTTTC -3'
(R):5'- TGGAACCTCAGCCCCTTCT -3'
Posted On2014-04-24