Incidental Mutation 'R1609:Prkra'
ID176659
Institutional Source Beutler Lab
Gene Symbol Prkra
Ensembl Gene ENSMUSG00000002731
Gene Nameprotein kinase, interferon inducible double stranded RNA dependent activator
Synonymslear, PRK, Pact, RAX
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R1609 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location76629898-76648015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76633592 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 242 (I242N)
Ref Sequence ENSEMBL: ENSMUSP00000002808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002808]
Predicted Effect probably benign
Transcript: ENSMUST00000002808
AA Change: I242N

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000002808
Gene: ENSMUSG00000002731
AA Change: I242N

DomainStartEndE-ValueType
DSRM 35 100 4.63e-24 SMART
DSRM 127 193 2.23e-17 SMART
DSRM 241 307 1.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140493
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein kinase activated by double-stranded RNA which mediates the effects of interferon in response to viral infection. Mutations in this gene have been associated with dystonia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a deletion of the entire gene show embryonic lethality prior to implantation. Mice homozygous for a deletion in the last exon are viable but exhibit small size, turbinate hypoplasia, short snout, severe microtia, outer and middle ear defects, and impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Prkra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Prkra APN 2 76630436 missense probably damaging 1.00
IGL02016:Prkra APN 2 76643309 splice site probably null
IGL02823:Prkra APN 2 76630424 missense probably damaging 1.00
IGL02962:Prkra APN 2 76633547 missense probably damaging 1.00
IGL03265:Prkra APN 2 76640270 missense probably benign 0.06
R1520:Prkra UTSW 2 76639278 missense possibly damaging 0.62
R1751:Prkra UTSW 2 76647240 missense possibly damaging 0.63
R1767:Prkra UTSW 2 76647240 missense possibly damaging 0.63
R2131:Prkra UTSW 2 76647136 missense probably damaging 1.00
R5288:Prkra UTSW 2 76639278 missense probably damaging 0.99
R5385:Prkra UTSW 2 76639278 missense probably damaging 0.99
R5386:Prkra UTSW 2 76639278 missense probably damaging 0.99
R6802:Prkra UTSW 2 76633537 missense probably damaging 1.00
R6918:Prkra UTSW 2 76630453 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGTGTTTTGCTCCCATAATCCC -3'
(R):5'- GCAAGCATTTGCTGCACTGAGG -3'

Sequencing Primer
(F):5'- TAATCCCACCCAGCCCTTG -3'
(R):5'- acccatctctccatcccc -3'
Posted On2014-04-24