Incidental Mutation 'R1609:Atpif1'
ID176667
Institutional Source Beutler Lab
Gene Symbol Atpif1
Ensembl Gene ENSMUSG00000054428
Gene NameATPase inhibitory factor 1
SynonymsIf1
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R1609 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location132530555-132533659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132530767 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 47 (D47G)
Ref Sequence ENSEMBL: ENSMUSP00000133099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067467] [ENSMUST00000067496] [ENSMUST00000094657] [ENSMUST00000105939] [ENSMUST00000105940] [ENSMUST00000138334] [ENSMUST00000139074] [ENSMUST00000144073] [ENSMUST00000152993]
Predicted Effect probably benign
Transcript: ENSMUST00000067467
SMART Domains Protein: ENSMUSP00000068069
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
SCOP:d1repc1 23 79 4e-5 SMART
Blast:DnaJ 56 79 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000067496
AA Change: D79G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000064282
Gene: ENSMUSG00000054428
AA Change: D79G

DomainStartEndE-ValueType
Pfam:IATP 26 106 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094657
SMART Domains Protein: ENSMUSP00000092242
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 56 115 2.65e-18 SMART
low complexity region 135 146 N/A INTRINSIC
coiled coil region 164 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105939
SMART Domains Protein: ENSMUSP00000101559
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 22 81 2.09e-16 SMART
low complexity region 101 112 N/A INTRINSIC
coiled coil region 130 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105940
SMART Domains Protein: ENSMUSP00000101560
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 56 96 2.15e-1 SMART
low complexity region 116 127 N/A INTRINSIC
coiled coil region 145 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124471
Predicted Effect probably benign
Transcript: ENSMUST00000138334
SMART Domains Protein: ENSMUSP00000130135
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
DnaJ 38 84 4.42e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142281
Predicted Effect probably benign
Transcript: ENSMUST00000144073
SMART Domains Protein: ENSMUSP00000131575
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145795
Predicted Effect probably benign
Transcript: ENSMUST00000150207
SMART Domains Protein: ENSMUSP00000121009
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
DnaJ 32 91 2.65e-18 SMART
low complexity region 111 122 N/A INTRINSIC
low complexity region 178 190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152993
AA Change: D47G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000133099
Gene: ENSMUSG00000054428
AA Change: D47G

DomainStartEndE-ValueType
Pfam:IATP 1 61 1.8e-28 PFAM
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: This gene encodes a member of the ATPase inhibitor family of proteins. This protein has been shown to negatively regulate the ATP hydrolysis activity of the F1Fo-ATPase. Knockdown of this gene is associated with reduced heme synthesis in differentiating erythroid cells. Misregulation of this gene has been found to lead to increased aerobic glycolysis in mouse cancer cells, while high expression levels of this gene have been correlated with gastric and liver cancer severity in human patients. A pseudogene of this gene has been identified. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Atpif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
macunaima UTSW 4 132533300 missense probably damaging 1.00
R4536:Atpif1 UTSW 4 132533559 missense possibly damaging 0.58
R5270:Atpif1 UTSW 4 132533300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGAAGGCATCAGGCAAGTTTCC -3'
(R):5'- GCCAATTTTCCCTCCCAACTCAGGA -3'

Sequencing Primer
(F):5'- ATCAGGCAAGTTTCCTGGTG -3'
(R):5'- gaactgaaccctgactccc -3'
Posted On2014-04-24