Incidental Mutation 'R1609:Vmn2r31'
ID176673
Institutional Source Beutler Lab
Gene Symbol Vmn2r31
Ensembl Gene ENSMUSG00000096373
Gene Namevomeronasal 2, receptor 31
Synonyms
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R1609 (G1)
Quality Score141
Status Validated
Chromosome7
Chromosomal Location7383027-7399743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7384889 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 561 (E561G)
Ref Sequence ENSEMBL: ENSMUSP00000074613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075108]
Predicted Effect probably damaging
Transcript: ENSMUST00000075108
AA Change: E561G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074613
Gene: ENSMUSG00000096373
AA Change: E561G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1e-33 PFAM
Pfam:NCD3G 512 565 1.4e-20 PFAM
Pfam:7tm_3 598 833 8.1e-55 PFAM
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Vmn2r31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Vmn2r31 APN 7 7396566 missense probably damaging 0.98
IGL01536:Vmn2r31 APN 7 7384848 missense probably damaging 1.00
IGL01985:Vmn2r31 APN 7 7394511 missense probably benign
IGL02116:Vmn2r31 APN 7 7394549 missense probably damaging 0.97
FR4304:Vmn2r31 UTSW 7 7384608 missense probably damaging 1.00
R4647:Vmn2r31 UTSW 7 7384368 missense probably damaging 1.00
R4724:Vmn2r31 UTSW 7 7384758 missense possibly damaging 0.63
R4824:Vmn2r31 UTSW 7 7387063 critical splice donor site probably null
R5619:Vmn2r31 UTSW 7 7384530 nonsense probably null
R6225:Vmn2r31 UTSW 7 7394639 missense probably benign 0.19
R6610:Vmn2r31 UTSW 7 7384589 missense probably damaging 0.97
R6956:Vmn2r31 UTSW 7 7394506 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTGGCTCTGTTAGGATGACCAATG -3'
(R):5'- TGGATTGAAAGCAATGCTCAGCAAC -3'

Sequencing Primer
(F):5'- CTGTTATTGGCCTTCACAATAGG -3'
(R):5'- GCAACAATATCCTTCACGTTACATTC -3'
Posted On2014-04-24