Incidental Mutation 'R1609:Tspan4'
ID176674
Institutional Source Beutler Lab
Gene Symbol Tspan4
Ensembl Gene ENSMUSG00000025511
Gene Nametetraspanin 4
SynonymsTspan-4, novel antigen 2, Tm4sf7, NAG-2, D130042I01Rik
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1609 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141475240-141493427 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141491644 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 135 (T135A)
Ref Sequence ENSEMBL: ENSMUSP00000113085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026585] [ENSMUST00000026586] [ENSMUST00000117634] [ENSMUST00000118694] [ENSMUST00000138092] [ENSMUST00000140858] [ENSMUST00000146305] [ENSMUST00000153191] [ENSMUST00000166082] [ENSMUST00000209452]
Predicted Effect probably damaging
Transcript: ENSMUST00000026585
AA Change: T135A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026585
Gene: ENSMUSG00000025511
AA Change: T135A

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 230 4.7e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026586
SMART Domains Protein: ENSMUSP00000026586
Gene: ENSMUSG00000025512

DomainStartEndE-ValueType
PDB:3BXW|A 4 240 1e-142 PDB
Blast:Glyco_18 82 302 1e-139 BLAST
SCOP:d1e9la1 84 240 1e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064642
SMART Domains Protein: ENSMUSP00000065953
Gene: ENSMUSG00000025512

DomainStartEndE-ValueType
PDB:3BXW|A 3 236 1e-143 PDB
Blast:Glyco_18 81 268 1e-121 BLAST
SCOP:d1e9la1 83 236 2e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117634
AA Change: T135A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113085
Gene: ENSMUSG00000025511
AA Change: T135A

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 230 1.1e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118694
SMART Domains Protein: ENSMUSP00000112891
Gene: ENSMUSG00000025512

DomainStartEndE-ValueType
PDB:3BXW|A 1 237 1e-142 PDB
Blast:Glyco_18 79 299 1e-139 BLAST
SCOP:d1e9la1 81 237 1e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130402
Predicted Effect possibly damaging
Transcript: ENSMUST00000138092
AA Change: T135A

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115421
Gene: ENSMUSG00000025511
AA Change: T135A

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 154 1.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140858
Predicted Effect possibly damaging
Transcript: ENSMUST00000146305
AA Change: T135A

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118533
Gene: ENSMUSG00000025511
AA Change: T135A

DomainStartEndE-ValueType
Pfam:Tetraspannin 8 158 2.5e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147610
Predicted Effect probably benign
Transcript: ENSMUST00000153191
SMART Domains Protein: ENSMUSP00000114693
Gene: ENSMUSG00000025512

DomainStartEndE-ValueType
low complexity region 22 32 N/A INTRINSIC
Glyco_18 79 385 3.54e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166082
SMART Domains Protein: ENSMUSP00000130360
Gene: ENSMUSG00000025512

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Glyco_18 82 388 3.54e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209452
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and is similar in sequence to its family member CD53 antigen. It is known to complex with integrins and other transmembrane 4 superfamily proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Tspan4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02701:Tspan4 APN 7 141492028 missense probably damaging 0.98
IGL03220:Tspan4 APN 7 141491799 missense probably damaging 1.00
R5286:Tspan4 UTSW 7 141482570 splice site probably null
R5335:Tspan4 UTSW 7 141489615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGGAAACAAGCAAGAGGTTCG -3'
(R):5'- GTACCAGGTTCATGTAACCCACAGC -3'

Sequencing Primer
(F):5'- CAAGCAAGAGGTTCGGGTAG -3'
(R):5'- ACACGAGTGGCATTGTATACCTC -3'
Posted On2014-04-24