Incidental Mutation 'R1609:Pgbd5'
ID176678
Institutional Source Beutler Lab
Gene Symbol Pgbd5
Ensembl Gene ENSMUSG00000050751
Gene NamepiggyBac transposable element derived 5
Synonyms
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R1609 (G1)
Quality Score113
Status Validated
Chromosome8
Chromosomal Location124369049-124439658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124434011 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 39 (D39G)
Ref Sequence ENSEMBL: ENSMUSP00000120984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052580] [ENSMUST00000140012] [ENSMUST00000172566]
Predicted Effect probably benign
Transcript: ENSMUST00000052580
SMART Domains Protein: ENSMUSP00000054788
Gene: ENSMUSG00000050751

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 6 372 5e-86 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140012
AA Change: D39G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000120984
Gene: ENSMUSG00000050751
AA Change: D39G

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 120 486 5.6e-90 PFAM
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172566
SMART Domains Protein: ENSMUSP00000133560
Gene: ENSMUSG00000050751

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 29 395 2e-86 PFAM
low complexity region 415 426 N/A INTRINSIC
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Pgbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Pgbd5 APN 8 124384202 missense probably benign 0.00
IGL01669:Pgbd5 APN 8 124374399 missense possibly damaging 0.86
IGL01759:Pgbd5 APN 8 124384379 missense probably damaging 1.00
IGL01762:Pgbd5 APN 8 124370610 missense probably damaging 1.00
IGL02398:Pgbd5 APN 8 124384518 missense probably damaging 1.00
R0348:Pgbd5 UTSW 8 124434032 missense probably damaging 0.98
R0702:Pgbd5 UTSW 8 124374255 missense probably benign 0.21
R0981:Pgbd5 UTSW 8 124384293 nonsense probably null
R1259:Pgbd5 UTSW 8 124370585 missense probably damaging 0.98
R1598:Pgbd5 UTSW 8 124374287 missense probably benign 0.26
R1742:Pgbd5 UTSW 8 124380307 missense probably damaging 1.00
R1938:Pgbd5 UTSW 8 124374249 nonsense probably null
R1985:Pgbd5 UTSW 8 124370592 missense probably benign 0.00
R2169:Pgbd5 UTSW 8 124384624 critical splice acceptor site probably null
R4573:Pgbd5 UTSW 8 124376227 nonsense probably null
R4917:Pgbd5 UTSW 8 124370566 missense probably benign 0.14
R4918:Pgbd5 UTSW 8 124370566 missense probably benign 0.14
R4946:Pgbd5 UTSW 8 124370585 missense possibly damaging 0.93
R5409:Pgbd5 UTSW 8 124371880 missense probably damaging 1.00
R5885:Pgbd5 UTSW 8 124384466 missense probably damaging 1.00
R5946:Pgbd5 UTSW 8 124374317 missense possibly damaging 0.83
R6907:Pgbd5 UTSW 8 124380282 missense probably damaging 0.97
R6986:Pgbd5 UTSW 8 124384473 missense possibly damaging 0.56
X0067:Pgbd5 UTSW 8 124371912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGTCCCTGCACCCCAGTG -3'
(R):5'- TGGGCAGCGGCTGAGTCTCTTC -3'

Sequencing Primer
(F):5'- GTCGATCCTCACCACCG -3'
(R):5'- AGCTCCAAGGCGCATCC -3'
Posted On2014-04-24