Incidental Mutation 'R1609:Rtp3'
ID176684
Institutional Source Beutler Lab
Gene Symbol Rtp3
Ensembl Gene ENSMUSG00000066319
Gene Namereceptor transporter protein 3
SynonymsTmem7
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R1609 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110984935-110990583 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 110986017 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035076] [ENSMUST00000084922] [ENSMUST00000198702] [ENSMUST00000199891]
Predicted Effect probably benign
Transcript: ENSMUST00000035076
SMART Domains Protein: ENSMUSP00000035076
Gene: ENSMUSG00000032495

DomainStartEndE-ValueType
Blast:LRR 143 165 5e-7 BLAST
LRR_TYP 166 189 4.87e-4 SMART
LRR 236 258 1.41e1 SMART
LRR 259 282 2.27e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000084922
AA Change: S427P
SMART Domains Protein: ENSMUSP00000081985
Gene: ENSMUSG00000066319
AA Change: S427P

DomainStartEndE-ValueType
zf-3CxxC 52 164 2.13e-52 SMART
low complexity region 356 404 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197321
Predicted Effect probably benign
Transcript: ENSMUST00000198702
SMART Domains Protein: ENSMUSP00000143100
Gene: ENSMUSG00000066319

DomainStartEndE-ValueType
Pfam:zf-3CxxC 52 81 2.5e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000199891
AA Change: S427P
SMART Domains Protein: ENSMUSP00000143305
Gene: ENSMUSG00000066319
AA Change: S427P

DomainStartEndE-ValueType
zf-3CxxC 52 164 2.13e-52 SMART
low complexity region 356 404 N/A INTRINSIC
low complexity region 458 474 N/A INTRINSIC
Meta Mutation Damage Score 0.0468 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Rtp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Rtp3 APN 9 110986598 missense probably benign 0.03
IGL02212:Rtp3 APN 9 110987321 splice site probably benign
IGL03033:Rtp3 APN 9 110986094 unclassified probably benign
R0392:Rtp3 UTSW 9 110989553 missense probably damaging 0.98
R0529:Rtp3 UTSW 9 110987084 missense possibly damaging 0.93
R0645:Rtp3 UTSW 9 110987100 missense probably damaging 0.97
R1282:Rtp3 UTSW 9 110986920 missense probably benign 0.01
R1649:Rtp3 UTSW 9 110986704 missense probably benign 0.00
R1662:Rtp3 UTSW 9 110986683 missense probably benign 0.23
R2011:Rtp3 UTSW 9 110986034 unclassified probably benign
R3697:Rtp3 UTSW 9 110987194 missense possibly damaging 0.86
R4661:Rtp3 UTSW 9 110986451 unclassified probably null
R4707:Rtp3 UTSW 9 110986211 unclassified probably benign
R4764:Rtp3 UTSW 9 110987350 intron probably benign
R4796:Rtp3 UTSW 9 110986454 missense probably benign 0.00
R4839:Rtp3 UTSW 9 110989476 missense probably damaging 1.00
R5262:Rtp3 UTSW 9 110986127 unclassified probably benign
R5886:Rtp3 UTSW 9 110987136 missense probably damaging 1.00
R5932:Rtp3 UTSW 9 110986692 missense probably benign 0.04
R6089:Rtp3 UTSW 9 110986973 missense probably benign 0.00
R6545:Rtp3 UTSW 9 110986826 missense possibly damaging 0.83
R6812:Rtp3 UTSW 9 110987112 missense probably benign 0.14
R6895:Rtp3 UTSW 9 110987196 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ATGAGAAGCTGCTACCATTTCCACC -3'
(R):5'- AGCTGTCAGTAGTAAGCCCACCTG -3'

Sequencing Primer
(F):5'- GGTCACATTGCTTAAACCGTG -3'
(R):5'- CCAAAGGCATTGCTCTCATC -3'
Posted On2014-04-24