Incidental Mutation 'R1609:Allc'
ID176687
Institutional Source Beutler Lab
Gene Symbol Allc
Ensembl Gene ENSMUSG00000020636
Gene Nameallantoicase
Synonyms1700012B22Rik
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R1609 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location28553755-28582523 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28553994 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 363 (D363E)
Ref Sequence ENSEMBL: ENSMUSP00000106542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020963] [ENSMUST00000020965] [ENSMUST00000110917] [ENSMUST00000221349]
Predicted Effect probably benign
Transcript: ENSMUST00000020963
SMART Domains Protein: ENSMUSP00000020963
Gene: ENSMUSG00000020633

DomainStartEndE-ValueType
DCX 11 98 2.16e-29 SMART
DCX 131 217 6.18e-7 SMART
low complexity region 302 316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000020965
AA Change: D363E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020965
Gene: ENSMUSG00000020636
AA Change: D363E

DomainStartEndE-ValueType
Pfam:Allantoicase 28 201 3e-51 PFAM
Pfam:Allantoicase 224 385 1.9e-39 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110917
AA Change: D363E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106542
Gene: ENSMUSG00000020636
AA Change: D363E

DomainStartEndE-ValueType
Pfam:Allantoicase 28 201 3e-51 PFAM
Pfam:Allantoicase 224 385 1.9e-39 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185916
Predicted Effect probably benign
Transcript: ENSMUST00000221349
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Allantoicase (EC 3.5.3.4) participates in the uric acid degradation pathway. Its enzymatic activity, like that of urate oxidase (MIM 191540), was lost during vertebrate evolution.[supplied by OMIM, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Allc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Allc APN 12 28564249 missense probably benign
IGL02869:Allc APN 12 28573207 missense probably benign 0.05
IGL03393:Allc APN 12 28560011 missense probably damaging 1.00
R0945:Allc UTSW 12 28559963 missense probably benign
R1997:Allc UTSW 12 28563483 missense probably benign 0.34
R4322:Allc UTSW 12 28554024 missense probably benign 0.00
R4837:Allc UTSW 12 28559309 missense probably benign 0.06
R5207:Allc UTSW 12 28555326 missense probably benign 0.09
R5469:Allc UTSW 12 28555306 missense probably benign 0.00
R6727:Allc UTSW 12 28557389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATCAAGACCAGTTTGTGGGGTG -3'
(R):5'- CACACATGCCATTGTCATGCGG -3'

Sequencing Primer
(F):5'- CGTTTTATTGGAACCACCAGG -3'
(R):5'- CACTAGCCGATTTCTGTTAGAGC -3'
Posted On2014-04-24