Incidental Mutation 'R1609:Acot2'
ID176689
Institutional Source Beutler Lab
Gene Symbol Acot2
Ensembl Gene ENSMUSG00000021226
Gene Nameacyl-CoA thioesterase 2
SynonymsMTE-I, Mte1
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1609 (G1)
Quality Score196
Status Validated
Chromosome12
Chromosomal Location83987861-83993873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83992856 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 380 (R380C)
Ref Sequence ENSEMBL: ENSMUSP00000021649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021649]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021649
AA Change: R380C

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021649
Gene: ENSMUSG00000021226
AA Change: R380C

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 57 182 3e-45 PFAM
low complexity region 189 202 N/A INTRINSIC
Pfam:BAAT_C 244 451 7.6e-86 PFAM
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA thioesterase protein family, and is one of four acyl-CoA hydrolase genes located in a cluster on chromosome 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Acot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0417:Acot2 UTSW 12 83990613 missense probably benign 0.36
R1101:Acot2 UTSW 12 83992850 missense probably benign 0.22
R2267:Acot2 UTSW 12 83990560 missense probably damaging 1.00
R6166:Acot2 UTSW 12 83992604 missense probably damaging 1.00
X0021:Acot2 UTSW 12 83988085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTTGGGAACACCATCTCCTAC -3'
(R):5'- AAGAAAGTCTGGAGCTGCTGCC -3'

Sequencing Primer
(F):5'- AGGATGAGACTATACCCCCTGTG -3'
(R):5'- TGCCATGCGTCCACCTG -3'
Posted On2014-04-24