Incidental Mutation 'R1609:Mapk1'
ID176693
Institutional Source Beutler Lab
Gene Symbol Mapk1
Ensembl Gene ENSMUSG00000063358
Gene Namemitogen-activated protein kinase 1
SynonymsPrkm1, p42mapk, 9030612K14Rik, MAPK2, Erk2
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1609 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location16983382-17047453 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 17038306 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023462] [ENSMUST00000069107] [ENSMUST00000115731] [ENSMUST00000129477] [ENSMUST00000232067] [ENSMUST00000232611]
Predicted Effect
SMART Domains Protein: ENSMUSP00000023462
Gene: ENSMUSG00000063358

DomainStartEndE-ValueType
S_TKc 23 311 1.06e-95 SMART
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069107
SMART Domains Protein: ENSMUSP00000065983
Gene: ENSMUSG00000063358

DomainStartEndE-ValueType
S_TKc 23 311 1.06e-95 SMART
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115731
SMART Domains Protein: ENSMUSP00000111396
Gene: ENSMUSG00000063358

DomainStartEndE-ValueType
S_TKc 23 311 1.06e-95 SMART
low complexity region 330 344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128958
Predicted Effect
SMART Domains Protein: ENSMUSP00000115125
Gene: ENSMUSG00000063358

DomainStartEndE-ValueType
Pfam:Pkinase 2 69 1.3e-5 PFAM
low complexity region 106 120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145409
Predicted Effect probably benign
Transcript: ENSMUST00000231821
Predicted Effect probably benign
Transcript: ENSMUST00000232067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232480
Predicted Effect probably benign
Transcript: ENSMUST00000232611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232630
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The activation of this kinase requires its phosphorylation by upstream kinases. Upon activation, this kinase translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. One study also suggests that this protein acts as a transcriptional repressor independent of its kinase activity. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Two alternatively spliced transcript variants encoding the same protein, but differing in the UTRs, have been reported for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutant embryos implant in the uterus, but die shortly thereafter failing to form extraembryonic tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Mapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Mapk1 APN 16 17035458 missense probably benign 0.00
IGL01486:Mapk1 APN 16 17018280 splice site probably benign
IGL01764:Mapk1 APN 16 16983733 missense possibly damaging 0.50
IGL02138:Mapk1 APN 16 17023452 missense probably benign 0.18
IGL02701:Mapk1 APN 16 17015906 missense probably benign 0.00
R0517:Mapk1 UTSW 16 17016046 missense probably benign 0.02
R1862:Mapk1 UTSW 16 17026429 missense probably benign 0.36
R2885:Mapk1 UTSW 16 17026445 missense probably benign
R4205:Mapk1 UTSW 16 17038457 intron probably benign
R4959:Mapk1 UTSW 16 17018306 missense probably damaging 1.00
R5694:Mapk1 UTSW 16 17018469 missense probably benign 0.02
R6630:Mapk1 UTSW 16 17026385 missense probably damaging 1.00
R6809:Mapk1 UTSW 16 17035462 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGTACTTGGGATAGTGCCCAGAGC -3'
(R):5'- ACACGACCGTCACAGTGTCTAAGG -3'

Sequencing Primer
(F):5'- GCTCTTGTATAGAGCACACATATCC -3'
(R):5'- TCACAGTGTCTAAGGGCTGC -3'
Posted On2014-04-24