Mutagenetix > Incidental Mutation

Incidental Mutation 'R1610:Nup214'

176708

Institutional Source

Beutler Lab

Gene Symbol

Nup214

Ensembl Gene

ENSMUSG00000001855

Gene Name

nucleoporin 214

Synonyms

CAN, D2H9S46E

MMRRC Submission

039647-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1610 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31864446-31943204 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 31924478 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 1669 (S1669F)

Ref Sequence

ENSEMBL: ENSMUSP00000066492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065398] [ENSMUST00000138012]

AlphaFold

Q80U93

Predicted Effect

probably damaging
Transcript: ENSMUST00000065398
AA Change: S1669F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: S1669F

Domain	Start	End	E-Value	Type
WD40	138	178	2.48e0	SMART
WD40	182	220	2.67e-1	SMART
low complexity region	428	441	N/A	INTRINSIC
low complexity region	449	467	N/A	INTRINSIC
low complexity region	474	493	N/A	INTRINSIC
low complexity region	529	546	N/A	INTRINSIC
low complexity region	620	640	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
coiled coil region	853	881	N/A	INTRINSIC
internal_repeat_1	969	993	1.13e-9	PROSPERO
internal_repeat_1	985	1009	1.13e-9	PROSPERO
low complexity region	1011	1026	N/A	INTRINSIC
low complexity region	1049	1064	N/A	INTRINSIC
low complexity region	1093	1111	N/A	INTRINSIC
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1226	1248	N/A	INTRINSIC
low complexity region	1279	1296	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1391	1426	N/A	INTRINSIC
low complexity region	1438	1454	N/A	INTRINSIC
low complexity region	1458	1505	N/A	INTRINSIC
low complexity region	1559	1573	N/A	INTRINSIC
low complexity region	1611	1642	N/A	INTRINSIC
low complexity region	1658	1670	N/A	INTRINSIC
low complexity region	1686	1715	N/A	INTRINSIC
low complexity region	1733	1748	N/A	INTRINSIC
low complexity region	1771	1783	N/A	INTRINSIC
low complexity region	1799	1832	N/A	INTRINSIC
low complexity region	1853	1872	N/A	INTRINSIC
low complexity region	1877	1886	N/A	INTRINSIC
low complexity region	1898	1910	N/A	INTRINSIC
low complexity region	1925	1934	N/A	INTRINSIC
low complexity region	1969	1995	N/A	INTRINSIC
low complexity region	2007	2032	N/A	INTRINSIC
low complexity region	2048	2076	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123062

Predicted Effect

possibly damaging
Transcript: ENSMUST00000138012
AA Change: S164F

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000115665
Gene: ENSMUSG00000001855
AA Change: S164F

Domain	Start	End	E-Value	Type
low complexity region	54	68	N/A	INTRINSIC
low complexity region	106	137	N/A	INTRINSIC
low complexity region	153	165	N/A	INTRINSIC
low complexity region	181	210	N/A	INTRINSIC
low complexity region	228	243	N/A	INTRINSIC
low complexity region	266	278	N/A	INTRINSIC
low complexity region	294	327	N/A	INTRINSIC
low complexity region	348	368	N/A	INTRINSIC
low complexity region	373	382	N/A	INTRINSIC
low complexity region	394	406	N/A	INTRINSIC
low complexity region	421	430	N/A	INTRINSIC
low complexity region	465	491	N/A	INTRINSIC
low complexity region	503	528	N/A	INTRINSIC
low complexity region	544	572	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd5	G	A	2: 22,980,563 (GRCm39)	C312Y	probably damaging	Het
Adgrl1	T	A	8: 84,659,002 (GRCm39)	M601K	probably benign	Het
Agbl4	G	A	4: 111,514,365 (GRCm39)	E459K	probably benign	Het
Anxa2	TCCC	TCC	9: 69,397,036 (GRCm39)		probably null	Het
Casz1	C	T	4: 149,013,544 (GRCm39)	A36V	possibly damaging	Het
Cfap20dc	G	T	14: 8,511,110 (GRCm38)	H435N	probably benign	Het
Chpf	A	G	1: 75,453,292 (GRCm39)	V327A	probably damaging	Het
Cldn23	A	G	8: 36,293,084 (GRCm39)	Y135H	probably damaging	Het
Cobll1	C	T	2: 64,963,986 (GRCm39)	D211N	probably damaging	Het
Cramp1	A	G	17: 25,202,925 (GRCm39)	V368A	probably benign	Het
Dnah6	T	C	6: 73,121,946 (GRCm39)	T1374A	probably benign	Het
Dpyd	A	G	3: 118,858,655 (GRCm39)	H623R	probably benign	Het
Dyrk2	T	C	10: 118,695,830 (GRCm39)	N476S	probably benign	Het
Endog	A	T	2: 30,063,899 (GRCm39)	I267F	probably damaging	Het
Ephb6	A	T	6: 41,591,307 (GRCm39)	K155*	probably null	Het
Far2	T	C	6: 148,058,956 (GRCm39)	V214A	possibly damaging	Het
Fat2	A	G	11: 55,169,750 (GRCm39)	V3003A	probably damaging	Het
Frg2f1	T	A	4: 119,388,485 (GRCm39)	T5S	possibly damaging	Het
Gm14496	A	T	2: 181,637,972 (GRCm39)	T349S	probably benign	Het
Golgb1	A	G	16: 36,746,463 (GRCm39)	T2951A	probably benign	Het
Hc	G	T	2: 34,896,173 (GRCm39)	D1203E	probably benign	Het
Isg20	C	A	7: 78,564,257 (GRCm39)	Q55K	possibly damaging	Het
Jph4	G	T	14: 55,351,560 (GRCm39)	A152E	probably damaging	Het
Kcnq3	T	C	15: 65,897,109 (GRCm39)	T264A	probably damaging	Het
Kcnq5	T	G	1: 21,527,685 (GRCm39)	T463P	probably damaging	Het
Klra8	A	G	6: 130,095,981 (GRCm39)	S204P	probably damaging	Het
Ldlrad1	A	G	4: 107,072,072 (GRCm39)	D98G	probably damaging	Het
Lhfpl4	T	C	6: 113,171,097 (GRCm39)	T30A	possibly damaging	Het
Lig1	T	A	7: 13,019,266 (GRCm39)	L80Q	probably damaging	Het
Lmbrd2	A	G	15: 9,186,699 (GRCm39)	Y558C	probably benign	Het
Lrrn3	G	T	12: 41,502,992 (GRCm39)	L442I	possibly damaging	Het
Mc2r	A	G	18: 68,540,519 (GRCm39)	F258S	probably damaging	Het
Mmp16	A	G	4: 18,011,582 (GRCm39)	T137A	probably benign	Het
Nfatc2ip	A	T	7: 125,986,579 (GRCm39)	S359T	probably damaging	Het
Nup50l	G	T	6: 96,142,270 (GRCm39)	P258Q	probably damaging	Het
Or10a48	T	A	7: 108,425,131 (GRCm39)	H25L	probably benign	Het
Or4c15b	T	C	2: 89,113,165 (GRCm39)	H104R	probably damaging	Het
Or4s2b	A	T	2: 88,508,918 (GRCm39)	K233*	probably null	Het
Or8b1b	C	T	9: 38,375,927 (GRCm39)	L197F	probably damaging	Het
Pacc1	A	G	1: 191,077,262 (GRCm39)	D195G	probably benign	Het
Plagl1	C	T	10: 13,004,706 (GRCm39)		probably benign	Het
Plxnb2	A	T	15: 89,042,696 (GRCm39)	S1531T	probably damaging	Het
Ptpn22	G	A	3: 103,809,512 (GRCm39)		probably null	Het
Rtn1	T	A	12: 72,266,053 (GRCm39)	Q174L	possibly damaging	Het
Selenoo	A	G	15: 88,984,119 (GRCm39)	E645G	probably benign	Het
Serpina1a	A	C	12: 103,820,096 (GRCm39)	D383E	possibly damaging	Het
Slc6a18	T	A	13: 73,816,344 (GRCm39)	Y345F	probably benign	Het
Smbd1	A	G	16: 32,627,135 (GRCm39)	V51A	possibly damaging	Het
Tchh	C	T	3: 93,352,146 (GRCm39)	R529W	unknown	Het
Tonsl	A	T	15: 76,522,757 (GRCm39)	Y165N	probably damaging	Het
Trdmt1	G	A	2: 13,520,870 (GRCm39)	T344I	probably damaging	Het
Ubash3b	C	A	9: 40,954,796 (GRCm39)	R116L	probably damaging	Het
Vmn2r94	A	G	17: 18,463,995 (GRCm39)	V765A	probably damaging	Het
Zfp474	C	T	18: 52,771,437 (GRCm39)	T30I	probably benign	Het

Other mutations in Nup214

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Nup214	APN	2	31,923,991 (GRCm39)	missense	probably damaging	1.00
IGL00649:Nup214	APN	2	31,896,733 (GRCm39)	missense	probably benign	0.27
IGL01149:Nup214	APN	2	31,924,712 (GRCm39)	missense	probably damaging	1.00
IGL01360:Nup214	APN	2	31,928,190 (GRCm39)	unclassified	probably benign
IGL01409:Nup214	APN	2	31,916,943 (GRCm39)	splice site	probably null
IGL01530:Nup214	APN	2	31,923,733 (GRCm39)	missense	probably benign
IGL01554:Nup214	APN	2	31,941,084 (GRCm39)	nonsense	probably null
IGL01944:Nup214	APN	2	31,924,971 (GRCm39)	nonsense	probably null
IGL02296:Nup214	APN	2	31,878,200 (GRCm39)	missense	possibly damaging	0.65
IGL02563:Nup214	APN	2	31,867,872 (GRCm39)	missense	probably damaging	1.00
IGL02688:Nup214	APN	2	31,921,287 (GRCm39)	missense	probably benign
IGL02858:Nup214	APN	2	31,900,384 (GRCm39)	splice site	probably benign
IGL02953:Nup214	APN	2	31,878,241 (GRCm39)	missense	possibly damaging	0.87
IGL03090:Nup214	APN	2	31,908,254 (GRCm39)	missense	probably benign	0.01
IGL03124:Nup214	APN	2	31,886,452 (GRCm39)	missense	probably benign	0.27
IGL03225:Nup214	APN	2	31,924,423 (GRCm39)	missense	probably damaging	1.00
IGL03375:Nup214	APN	2	31,900,233 (GRCm39)	missense	probably damaging	0.97
Des_moines	UTSW	2	31,870,596 (GRCm39)	splice site	probably null
ANU74:Nup214	UTSW	2	31,924,978 (GRCm39)	missense	probably damaging	0.99
R0035:Nup214	UTSW	2	31,880,379 (GRCm39)	splice site	probably null
R0243:Nup214	UTSW	2	31,888,069 (GRCm39)	splice site	probably benign
R0270:Nup214	UTSW	2	31,924,826 (GRCm39)	missense	probably damaging	0.96
R0358:Nup214	UTSW	2	31,894,312 (GRCm39)	splice site	probably null
R1168:Nup214	UTSW	2	31,915,313 (GRCm39)	missense	probably benign
R1242:Nup214	UTSW	2	31,867,782 (GRCm39)	missense	probably benign	0.00
R1481:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1482:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1579:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1580:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1581:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1894:Nup214	UTSW	2	31,886,392 (GRCm39)	missense	possibly damaging	0.66
R2146:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R2149:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R2293:Nup214	UTSW	2	31,916,887 (GRCm39)	missense	probably benign
R2924:Nup214	UTSW	2	31,888,015 (GRCm39)	missense	probably damaging	1.00
R2925:Nup214	UTSW	2	31,888,015 (GRCm39)	missense	probably damaging	1.00
R3037:Nup214	UTSW	2	31,866,632 (GRCm39)	missense	probably benign	0.00
R3426:Nup214	UTSW	2	31,923,415 (GRCm39)	missense	probably damaging	0.97
R3799:Nup214	UTSW	2	31,924,694 (GRCm39)	missense	probably damaging	1.00
R3843:Nup214	UTSW	2	31,941,112 (GRCm39)	missense	probably damaging	1.00
R4323:Nup214	UTSW	2	31,884,696 (GRCm39)	missense	probably benign
R4353:Nup214	UTSW	2	31,867,929 (GRCm39)	critical splice donor site	probably null
R4601:Nup214	UTSW	2	31,887,977 (GRCm39)	missense	probably benign	0.36
R4626:Nup214	UTSW	2	31,923,416 (GRCm39)	missense	possibly damaging	0.92
R4874:Nup214	UTSW	2	31,870,596 (GRCm39)	splice site	probably null
R4938:Nup214	UTSW	2	31,873,171 (GRCm39)	missense	probably benign	0.00
R4939:Nup214	UTSW	2	31,873,171 (GRCm39)	missense	probably benign	0.00
R5027:Nup214	UTSW	2	31,881,329 (GRCm39)	missense	probably damaging	1.00
R5358:Nup214	UTSW	2	31,907,158 (GRCm39)	missense	unknown
R5406:Nup214	UTSW	2	31,892,619 (GRCm39)	missense	probably damaging	0.96
R5507:Nup214	UTSW	2	31,878,188 (GRCm39)	missense	possibly damaging	0.87
R5695:Nup214	UTSW	2	31,924,385 (GRCm39)	missense	probably damaging	1.00
R5744:Nup214	UTSW	2	31,900,308 (GRCm39)	missense	probably damaging	0.97
R5908:Nup214	UTSW	2	31,881,353 (GRCm39)	missense	probably benign	0.03
R5967:Nup214	UTSW	2	31,869,790 (GRCm39)	missense	possibly damaging	0.52
R6140:Nup214	UTSW	2	31,941,808 (GRCm39)	missense	possibly damaging	0.92
R6243:Nup214	UTSW	2	31,892,944 (GRCm39)	missense	possibly damaging	0.81
R6488:Nup214	UTSW	2	31,881,384 (GRCm39)	missense	possibly damaging	0.93
R6934:Nup214	UTSW	2	31,872,683 (GRCm39)	nonsense	probably null
R6970:Nup214	UTSW	2	31,941,810 (GRCm39)	missense	probably damaging	1.00
R7028:Nup214	UTSW	2	31,924,168 (GRCm39)	missense	probably benign	0.22
R7114:Nup214	UTSW	2	31,915,256 (GRCm39)	missense	possibly damaging	0.83
R7120:Nup214	UTSW	2	31,941,054 (GRCm39)	missense	probably benign	0.07
R7249:Nup214	UTSW	2	31,878,245 (GRCm39)	missense	possibly damaging	0.92
R7821:Nup214	UTSW	2	31,916,917 (GRCm39)	missense	possibly damaging	0.83
R8026:Nup214	UTSW	2	31,923,362 (GRCm39)	missense	possibly damaging	0.55
R8264:Nup214	UTSW	2	31,884,738 (GRCm39)	missense	possibly damaging	0.79
R8284:Nup214	UTSW	2	31,886,458 (GRCm39)	missense	possibly damaging	0.83
R8356:Nup214	UTSW	2	31,929,372 (GRCm39)	missense	probably benign	0.05
R8397:Nup214	UTSW	2	31,880,266 (GRCm39)	missense	probably damaging	0.96
R8456:Nup214	UTSW	2	31,929,372 (GRCm39)	missense	probably benign	0.05
R8785:Nup214	UTSW	2	31,924,465 (GRCm39)	missense	probably damaging	0.97
R9257:Nup214	UTSW	2	31,923,347 (GRCm39)	missense	possibly damaging	0.92
R9291:Nup214	UTSW	2	31,867,806 (GRCm39)	missense	probably benign	0.00
R9376:Nup214	UTSW	2	31,924,244 (GRCm39)	missense	probably benign	0.00
R9408:Nup214	UTSW	2	31,937,523 (GRCm39)	missense	probably damaging	1.00
R9613:Nup214	UTSW	2	31,901,035 (GRCm39)	missense	possibly damaging	0.90
R9789:Nup214	UTSW	2	31,907,227 (GRCm39)	missense	possibly damaging	0.46
RF015:Nup214	UTSW	2	31,924,718 (GRCm39)	missense	probably benign	0.00
X0026:Nup214	UTSW	2	31,910,318 (GRCm39)	missense	possibly damaging	0.46
X0065:Nup214	UTSW	2	31,932,488 (GRCm39)	missense	probably damaging	1.00
Z1088:Nup214	UTSW	2	31,901,235 (GRCm39)	missense	probably benign	0.27
Z1176:Nup214	UTSW	2	31,924,237 (GRCm39)	nonsense	probably null
Z1176:Nup214	UTSW	2	31,900,270 (GRCm39)	missense	possibly damaging	0.66
Z1177:Nup214	UTSW	2	31,887,971 (GRCm39)	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GCATCTCTGCAAACTTCTGACCCTG -3'
(R):5'- AATGCTGTCTGTCCGAACACTCC -3'

Sequencing Primer
(F):5'- AGAACCTGTTCTTGTGCAGAC -3'
(R):5'- CTCCAGGAGCTGAAGCAC -3'

Posted On

2014-04-24