Incidental Mutation 'R1610:Dpyd'
ID176717
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Namedihydropyrimidine dehydrogenase
SynonymsDPD, E330028L06Rik
MMRRC Submission 039647-MU
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R1610 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location118562129-119432918 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119065006 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 623 (H623R)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
Predicted Effect probably benign
Transcript: ENSMUST00000039177
AA Change: H623R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: H623R

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik G T 6: 96,165,289 P258Q probably damaging Het
4930452B06Rik G T 14: 8,511,110 H435N probably benign Het
AA415398 T A 4: 119,531,288 T5S possibly damaging Het
Acbd5 G A 2: 23,090,551 C301Y probably damaging Het
Adgrl1 T A 8: 83,932,373 M601K probably benign Het
Agbl4 G A 4: 111,657,168 E459K probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Casz1 C T 4: 148,929,087 A36V possibly damaging Het
Chpf A G 1: 75,476,648 V327A probably damaging Het
Cldn23 A G 8: 35,825,930 Y135H probably damaging Het
Cobll1 C T 2: 65,133,642 D212N probably damaging Het
Cramp1l A G 17: 24,983,951 V368A probably benign Het
Dnah6 T C 6: 73,144,963 T1374A probably benign Het
Dyrk2 T C 10: 118,859,925 N476S probably benign Het
Endog A T 2: 30,173,887 I267F probably damaging Het
Ephb6 A T 6: 41,614,373 K155* probably null Het
Far2 T C 6: 148,157,458 V214A possibly damaging Het
Fat2 A G 11: 55,278,924 V3003A probably damaging Het
Gm14496 A T 2: 181,996,179 T349S probably benign Het
Gm933 A G 16: 32,806,765 V51A possibly damaging Het
Golgb1 A G 16: 36,926,101 T2992A probably benign Het
Hc G T 2: 35,006,161 D1203E probably benign Het
Isg20 C A 7: 78,914,509 Q55K possibly damaging Het
Jph4 G T 14: 55,114,103 A152E probably damaging Het
Kcnq3 T C 15: 66,025,260 T264A probably damaging Het
Kcnq5 T G 1: 21,457,461 T491P probably damaging Het
Klra8 A G 6: 130,119,018 S204P probably damaging Het
Ldlrad1 A G 4: 107,214,875 D98G probably damaging Het
Lhfpl4 T C 6: 113,194,136 T30A probably damaging Het
Lig1 T A 7: 13,285,340 L80Q probably damaging Het
Lmbrd2 A G 15: 9,186,612 Y603C probably benign Het
Lrrn3 G T 12: 41,452,993 L442I possibly damaging Het
Mc2r A G 18: 68,407,448 F258S probably damaging Het
Mmp16 A G 4: 18,011,582 T166A probably benign Het
Nfatc2ip A T 7: 126,387,407 S359T probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1193 A T 2: 88,678,574 K240* probably null Het
Olfr1229 T C 2: 89,282,821 H125R probably damaging Het
Olfr514 T A 7: 108,825,924 H25L probably benign Het
Olfr904 C T 9: 38,464,631 L197F probably damaging Het
Plagl1 C T 10: 13,128,962 A658V unknown Het
Plxnb2 A T 15: 89,158,493 S1531T probably damaging Het
Ptpn22 G A 3: 103,902,196 probably null Het
Rtn1 T A 12: 72,219,279 Q174L possibly damaging Het
Selo A G 15: 89,099,916 E645G probably benign Het
Serpina1a A C 12: 103,853,837 D383E possibly damaging Het
Slc6a18 T A 13: 73,668,225 Y345F probably benign Het
Tchh C T 3: 93,444,839 R529W unknown Het
Tmem206 A G 1: 191,345,065 D195G probably benign Het
Tonsl A T 15: 76,638,557 Y165N probably damaging Het
Trdmt1 G A 2: 13,516,059 T344I probably damaging Het
Ubash3b C A 9: 41,043,500 R238L probably damaging Het
Vmn2r94 A G 17: 18,243,733 V765A probably damaging Het
Zfp474 C T 18: 52,638,365 T30I probably benign Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably benign
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice acceptor site noncoding transcript
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGGTTTCTTTGTAGAACAGGGACTC -3'
(R):5'- TGCGCCCAGTGCCCATTTATAAC -3'

Sequencing Primer
(F):5'- CTTGTATGGCCCTGGACAAA -3'
(R):5'- TATAACAAAGCCTCACATTGGGAG -3'
Posted OnApr 24, 2014