Incidental Mutation 'R1611:Kif24'
ID176781
Institutional Source Beutler Lab
Gene Symbol Kif24
Ensembl Gene ENSMUSG00000028438
Gene Namekinesin family member 24
Synonyms4933425J19Rik
MMRRC Submission 039648-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R1611 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41390745-41464887 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41423552 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 233 (V233E)
Ref Sequence ENSEMBL: ENSMUSP00000103690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030148] [ENSMUST00000108055] [ENSMUST00000154535]
Predicted Effect probably benign
Transcript: ENSMUST00000030148
AA Change: V233E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000030148
Gene: ENSMUSG00000028438
AA Change: V233E

DomainStartEndE-ValueType
KISc 216 413 2.51e-29 SMART
low complexity region 481 499 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 626 644 N/A INTRINSIC
low complexity region 678 695 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108055
AA Change: V233E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103690
Gene: ENSMUSG00000028438
AA Change: V233E

DomainStartEndE-ValueType
Blast:KISc 82 205 1e-47 BLAST
KISc 216 547 3.09e-134 SMART
low complexity region 615 633 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
low complexity region 760 778 N/A INTRINSIC
low complexity region 812 829 N/A INTRINSIC
low complexity region 1253 1264 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154175
Predicted Effect probably benign
Transcript: ENSMUST00000154535
SMART Domains Protein: ENSMUSP00000119009
Gene: ENSMUSG00000028438

DomainStartEndE-ValueType
Pfam:SAM_1 2 62 6.3e-7 PFAM
Blast:KISc 82 142 2e-20 BLAST
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kinesins, such as KIF24, are microtubule-dependent ATPases that function as molecular motors. They play important roles in intracellular vesicle transport and cell division (summary by Venturelli et al., 2010 [PubMed 20670673]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G A 1: 136,216,117 P527L probably damaging Het
Acsl6 A T 11: 54,325,564 I186F possibly damaging Het
Actr6 T A 10: 89,732,202 K14* probably null Het
Adgrv1 A T 13: 81,559,117 V1390E probably damaging Het
Akap1 C T 11: 88,845,278 R186K probably benign Het
Alg10b T A 15: 90,225,781 V99D probably damaging Het
Atp2c1 C T 9: 105,442,852 G407S probably damaging Het
Atp9a T C 2: 168,673,569 M401V probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bclaf1 T C 10: 20,323,252 probably benign Het
Bcr T A 10: 75,125,202 probably null Het
Bivm T C 1: 44,126,747 I119T possibly damaging Het
Cacna1h A G 17: 25,381,471 I1632T probably damaging Het
Capn9 G A 8: 124,611,512 V537M possibly damaging Het
Cdk11b G A 4: 155,641,575 probably benign Het
Cdk18 T A 1: 132,122,375 I21F probably damaging Het
Cep85l T C 10: 53,348,681 T271A probably benign Het
Chrm5 T C 2: 112,479,187 N528S possibly damaging Het
Cpsf6 T A 10: 117,361,828 probably benign Het
Cpt1c T C 7: 44,960,112 T689A probably benign Het
D030068K23Rik T C 8: 109,249,303 Y64C unknown Het
Ddb1 T A 19: 10,612,888 C260S probably damaging Het
Ddb1 T A 19: 10,626,764 probably null Het
Ddx58 T C 4: 40,223,862 Y339C probably damaging Het
Depdc5 C A 5: 32,990,953 Q1478K probably damaging Het
Diaph1 A C 18: 37,900,702 M247R unknown Het
Dusp8 T C 7: 142,082,957 S299G probably benign Het
Erbb4 C A 1: 68,040,388 G1178C probably damaging Het
Exoc7 A T 11: 116,295,265 I370N possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm12353 T A 4: 19,631,843 Y27* probably null Het
Gnl1 C T 17: 35,987,549 T395I probably damaging Het
Hpse2 G A 19: 42,789,065 T554I probably damaging Het
Hsd17b11 T C 5: 104,009,899 I116V probably benign Het
Klhl5 A G 5: 65,164,649 T673A probably benign Het
Kmt2c C A 5: 25,359,311 probably null Het
Lipg T C 18: 74,948,059 N317S possibly damaging Het
Lpin1 A T 12: 16,577,218 L109Q probably null Het
Lyst A G 13: 13,634,897 E384G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Muc4 C T 16: 32,750,986 T288I possibly damaging Het
Naa35 G T 13: 59,628,933 R574L probably benign Het
Ncor2 T C 5: 125,110,020 probably benign Het
Nedd9 T A 13: 41,316,930 D249V probably benign Het
Nsg1 T A 5: 38,138,716 K38* probably null Het
Nup155 T A 15: 8,130,160 D518E probably damaging Het
Olfr152 T A 2: 87,782,624 I28N probably benign Het
Ovol1 T A 19: 5,551,070 H231L probably damaging Het
Parg A G 14: 32,238,570 I586V probably damaging Het
Pde7b T C 10: 20,434,490 N242S probably benign Het
Pias3 T A 3: 96,699,697 probably null Het
Pramef12 A T 4: 144,392,812 V395E probably benign Het
Ptprf A G 4: 118,236,233 V404A probably benign Het
Rnf145 T C 11: 44,551,798 L259P probably damaging Het
Rps6ka5 C G 12: 100,570,852 V540L possibly damaging Het
Ryr3 C T 2: 112,653,505 D3966N possibly damaging Het
Samd9l A T 6: 3,373,771 S1163R probably benign Het
Serpinb9g T C 13: 33,492,874 I213T possibly damaging Het
Sil1 A T 18: 35,269,088 V331E possibly damaging Het
Ski A G 4: 155,159,938 F410S probably damaging Het
Slc25a25 C T 2: 32,420,379 E123K probably damaging Het
Slfnl1 A G 4: 120,533,377 E75G probably benign Het
Sp1 T A 15: 102,430,935 I436N probably damaging Het
Taf4b A T 18: 14,844,469 E766V probably null Het
Tgfbr1 A G 4: 47,396,526 Y180C probably damaging Het
Ube4a T C 9: 44,956,737 probably benign Het
Vmn2r1 T A 3: 64,104,537 C606* probably null Het
Wdr63 T C 3: 146,095,358 Y115C probably damaging Het
Zfp341 C A 2: 154,645,703 H702Q probably damaging Het
Other mutations in Kif24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Kif24 APN 4 41413826 splice site probably null
IGL00787:Kif24 APN 4 41397583 missense probably damaging 1.00
IGL01065:Kif24 APN 4 41423639 unclassified probably benign
IGL01716:Kif24 APN 4 41393454 missense probably benign 0.40
IGL01796:Kif24 APN 4 41392978 unclassified probably benign
IGL02307:Kif24 APN 4 41395274 missense probably benign 0.02
IGL03061:Kif24 APN 4 41394323 missense possibly damaging 0.86
IGL03080:Kif24 APN 4 41394417 missense probably benign 0.12
IGL03100:Kif24 APN 4 41394446 missense possibly damaging 0.59
R0226:Kif24 UTSW 4 41414939 nonsense probably null
R0345:Kif24 UTSW 4 41428413 missense probably benign 0.01
R0365:Kif24 UTSW 4 41428731 missense probably benign 0.06
R0366:Kif24 UTSW 4 41428717 missense possibly damaging 0.77
R0579:Kif24 UTSW 4 41393706 missense probably damaging 0.97
R0682:Kif24 UTSW 4 41428620 missense probably benign 0.01
R1634:Kif24 UTSW 4 41393529 missense probably benign 0.02
R1772:Kif24 UTSW 4 41409787 missense probably damaging 1.00
R1997:Kif24 UTSW 4 41392904 missense possibly damaging 0.92
R3833:Kif24 UTSW 4 41395064 missense probably damaging 1.00
R3849:Kif24 UTSW 4 41404734 missense probably damaging 1.00
R4356:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4357:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4358:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4359:Kif24 UTSW 4 41413827 critical splice donor site probably null
R4406:Kif24 UTSW 4 41393954 missense probably damaging 1.00
R4580:Kif24 UTSW 4 41395287 missense probably damaging 1.00
R4756:Kif24 UTSW 4 41397545 critical splice donor site probably null
R4921:Kif24 UTSW 4 41394329 missense probably damaging 0.99
R4935:Kif24 UTSW 4 41394939 missense probably damaging 0.99
R5288:Kif24 UTSW 4 41395373 missense probably benign 0.09
R5398:Kif24 UTSW 4 41394401 missense possibly damaging 0.50
R5885:Kif24 UTSW 4 41423463 missense probably damaging 1.00
R5901:Kif24 UTSW 4 41428604 missense probably damaging 1.00
R5919:Kif24 UTSW 4 41394477 missense possibly damaging 0.62
R5945:Kif24 UTSW 4 41428670 nonsense probably null
R6278:Kif24 UTSW 4 41423498 missense probably damaging 1.00
R6291:Kif24 UTSW 4 41413959 missense probably damaging 1.00
R6891:Kif24 UTSW 4 41394168 missense probably benign 0.33
Z1088:Kif24 UTSW 4 41395091 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAGACCAAGCATCACTCTCAACAA -3'
(R):5'- GGATGAGGTAGTGTAGGTCAGAGATGAAA -3'

Sequencing Primer
(F):5'- gcacatgccattagtcccag -3'
(R):5'- tgaaaccctgtctcaaaataaaacc -3'
Posted On2014-04-24