Incidental Mutation 'R1611:Atp2c1'
ID176801
Institutional Source Beutler Lab
Gene Symbol Atp2c1
Ensembl Gene ENSMUSG00000032570
Gene NameATPase, Ca++-sequestering
SynonymsD930003G21Rik, SPCA, ATP2C1A, PMR1, 1700121J11Rik
MMRRC Submission 039648-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R1611 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105403539-105527319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105442852 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 407 (G407S)
Ref Sequence ENSEMBL: ENSMUSP00000135646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038118] [ENSMUST00000085133] [ENSMUST00000112558] [ENSMUST00000163879] [ENSMUST00000176770] [ENSMUST00000177074] [ENSMUST00000177293]
Predicted Effect probably damaging
Transcript: ENSMUST00000038118
AA Change: G407S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039103
Gene: ENSMUSG00000032570
AA Change: G407S

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 2.3e-75 PFAM
Pfam:Hydrolase 343 655 2.9e-31 PFAM
Pfam:HAD 346 652 7.7e-15 PFAM
Pfam:Hydrolase_like2 408 492 9.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 897 4e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085133
AA Change: G441S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082220
Gene: ENSMUSG00000032570
AA Change: G441S

DomainStartEndE-ValueType
Cation_ATPase_N 59 133 1.85e-14 SMART
Pfam:E1-E2_ATPase 138 372 3.4e-62 PFAM
Pfam:Hydrolase 377 689 2.6e-23 PFAM
Pfam:HAD 380 686 7.8e-14 PFAM
Pfam:Cation_ATPase 442 526 3.2e-19 PFAM
low complexity region 740 755 N/A INTRINSIC
Pfam:Cation_ATPase_C 759 931 3.8e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112558
AA Change: G407S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108177
Gene: ENSMUSG00000032570
AA Change: G407S

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 2.3e-75 PFAM
Pfam:Hydrolase 343 655 2.9e-31 PFAM
Pfam:HAD 346 652 7.7e-15 PFAM
Pfam:Hydrolase_like2 408 492 9.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 897 4e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163879
AA Change: G391S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129617
Gene: ENSMUSG00000032570
AA Change: G391S

DomainStartEndE-ValueType
Cation_ATPase_N 9 83 1.85e-14 SMART
Pfam:E1-E2_ATPase 89 323 5.2e-76 PFAM
Pfam:Hydrolase 327 639 5.6e-32 PFAM
Pfam:HAD 330 636 1.4e-15 PFAM
Pfam:Hydrolase_like2 392 476 3.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176770
AA Change: G402S

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134764
Gene: ENSMUSG00000032570
AA Change: G402S

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 100 334 8.9e-76 PFAM
Pfam:Hydrolase 338 650 1.1e-31 PFAM
Pfam:HAD 341 647 2.7e-15 PFAM
Pfam:Hydrolase_like2 403 487 4.8e-20 PFAM
low complexity region 701 716 N/A INTRINSIC
Pfam:Cation_ATPase_C 720 892 1.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177000
Predicted Effect probably damaging
Transcript: ENSMUST00000177074
AA Change: G407S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135646
Gene: ENSMUSG00000032570
AA Change: G407S

DomainStartEndE-ValueType
Cation_ATPase_N 25 99 1.85e-14 SMART
Pfam:E1-E2_ATPase 105 339 8.2e-76 PFAM
Pfam:Hydrolase 343 655 1e-31 PFAM
Pfam:HAD 346 652 2.5e-15 PFAM
Pfam:Hydrolase_like2 408 492 4.5e-20 PFAM
low complexity region 706 721 N/A INTRINSIC
Pfam:Cation_ATPase_C 725 886 7e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177293
AA Change: G271S

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135802
Gene: ENSMUSG00000032570
AA Change: G271S

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 1 203 6.7e-64 PFAM
Pfam:Hydrolase 207 519 7.4e-32 PFAM
Pfam:HAD 210 516 1.9e-15 PFAM
Pfam:Hydrolase_like2 272 356 3.8e-20 PFAM
transmembrane domain 564 586 N/A INTRINSIC
Pfam:Cation_ATPase_C 589 761 1.2e-47 PFAM
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium ions. Defects in this gene cause Hailey-Hailey disease, an autosomal dominant disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth retardation, failure of rostral neural tube closure, Golgi and endoplasmic reticulum stress, increased apoptosis, accumulation of intracellular lipid droplets and midgestational lethality. Agedheterozygotes develop squamous cell tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G A 1: 136,216,117 P527L probably damaging Het
Acsl6 A T 11: 54,325,564 I186F possibly damaging Het
Actr6 T A 10: 89,732,202 K14* probably null Het
Adgrv1 A T 13: 81,559,117 V1390E probably damaging Het
Akap1 C T 11: 88,845,278 R186K probably benign Het
Alg10b T A 15: 90,225,781 V99D probably damaging Het
Atp9a T C 2: 168,673,569 M401V probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bclaf1 T C 10: 20,323,252 probably benign Het
Bcr T A 10: 75,125,202 probably null Het
Bivm T C 1: 44,126,747 I119T possibly damaging Het
Cacna1h A G 17: 25,381,471 I1632T probably damaging Het
Capn9 G A 8: 124,611,512 V537M possibly damaging Het
Cdk11b G A 4: 155,641,575 probably benign Het
Cdk18 T A 1: 132,122,375 I21F probably damaging Het
Cep85l T C 10: 53,348,681 T271A probably benign Het
Chrm5 T C 2: 112,479,187 N528S possibly damaging Het
Cpsf6 T A 10: 117,361,828 probably benign Het
Cpt1c T C 7: 44,960,112 T689A probably benign Het
D030068K23Rik T C 8: 109,249,303 Y64C unknown Het
Ddb1 T A 19: 10,612,888 C260S probably damaging Het
Ddb1 T A 19: 10,626,764 probably null Het
Ddx58 T C 4: 40,223,862 Y339C probably damaging Het
Depdc5 C A 5: 32,990,953 Q1478K probably damaging Het
Diaph1 A C 18: 37,900,702 M247R unknown Het
Dusp8 T C 7: 142,082,957 S299G probably benign Het
Erbb4 C A 1: 68,040,388 G1178C probably damaging Het
Exoc7 A T 11: 116,295,265 I370N possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm12353 T A 4: 19,631,843 Y27* probably null Het
Gnl1 C T 17: 35,987,549 T395I probably damaging Het
Hpse2 G A 19: 42,789,065 T554I probably damaging Het
Hsd17b11 T C 5: 104,009,899 I116V probably benign Het
Kif24 A T 4: 41,423,552 V233E probably benign Het
Klhl5 A G 5: 65,164,649 T673A probably benign Het
Kmt2c C A 5: 25,359,311 probably null Het
Lipg T C 18: 74,948,059 N317S possibly damaging Het
Lpin1 A T 12: 16,577,218 L109Q probably null Het
Lyst A G 13: 13,634,897 E384G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Muc4 C T 16: 32,750,986 T288I possibly damaging Het
Naa35 G T 13: 59,628,933 R574L probably benign Het
Ncor2 T C 5: 125,110,020 probably benign Het
Nedd9 T A 13: 41,316,930 D249V probably benign Het
Nsg1 T A 5: 38,138,716 K38* probably null Het
Nup155 T A 15: 8,130,160 D518E probably damaging Het
Olfr152 T A 2: 87,782,624 I28N probably benign Het
Ovol1 T A 19: 5,551,070 H231L probably damaging Het
Parg A G 14: 32,238,570 I586V probably damaging Het
Pde7b T C 10: 20,434,490 N242S probably benign Het
Pias3 T A 3: 96,699,697 probably null Het
Pramef12 A T 4: 144,392,812 V395E probably benign Het
Ptprf A G 4: 118,236,233 V404A probably benign Het
Rnf145 T C 11: 44,551,798 L259P probably damaging Het
Rps6ka5 C G 12: 100,570,852 V540L possibly damaging Het
Ryr3 C T 2: 112,653,505 D3966N possibly damaging Het
Samd9l A T 6: 3,373,771 S1163R probably benign Het
Serpinb9g T C 13: 33,492,874 I213T possibly damaging Het
Sil1 A T 18: 35,269,088 V331E possibly damaging Het
Ski A G 4: 155,159,938 F410S probably damaging Het
Slc25a25 C T 2: 32,420,379 E123K probably damaging Het
Slfnl1 A G 4: 120,533,377 E75G probably benign Het
Sp1 T A 15: 102,430,935 I436N probably damaging Het
Taf4b A T 18: 14,844,469 E766V probably null Het
Tgfbr1 A G 4: 47,396,526 Y180C probably damaging Het
Ube4a T C 9: 44,956,737 probably benign Het
Vmn2r1 T A 3: 64,104,537 C606* probably null Het
Wdr63 T C 3: 146,095,358 Y115C probably damaging Het
Zfp341 C A 2: 154,645,703 H702Q probably damaging Het
Other mutations in Atp2c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Atp2c1 APN 9 105418579 missense probably damaging 1.00
IGL01682:Atp2c1 APN 9 105452842 missense probably damaging 1.00
IGL01874:Atp2c1 APN 9 105448825 missense probably damaging 1.00
IGL02299:Atp2c1 APN 9 105461087 unclassified probably benign
IGL03186:Atp2c1 APN 9 105413130 missense probably benign 0.10
IGL03212:Atp2c1 APN 9 105445267 missense probably damaging 1.00
IGL02799:Atp2c1 UTSW 9 105413043 unclassified probably benign
IGL03047:Atp2c1 UTSW 9 105521007 intron probably benign
R0885:Atp2c1 UTSW 9 105421573 critical splice donor site probably null
R1072:Atp2c1 UTSW 9 105459744 missense possibly damaging 0.92
R1469:Atp2c1 UTSW 9 105435152 nonsense probably null
R1469:Atp2c1 UTSW 9 105435152 nonsense probably null
R1638:Atp2c1 UTSW 9 105432698 missense probably damaging 0.96
R1667:Atp2c1 UTSW 9 105432797 missense probably null 0.94
R1722:Atp2c1 UTSW 9 105439400 missense probably benign 0.01
R1734:Atp2c1 UTSW 9 105414655 missense probably damaging 1.00
R1782:Atp2c1 UTSW 9 105431587 missense probably damaging 0.99
R1964:Atp2c1 UTSW 9 105446123 missense probably damaging 1.00
R2008:Atp2c1 UTSW 9 105432726 missense probably benign 0.00
R2093:Atp2c1 UTSW 9 105418121 nonsense probably null
R3720:Atp2c1 UTSW 9 105422976 missense probably damaging 1.00
R4118:Atp2c1 UTSW 9 105466659 missense probably damaging 1.00
R4273:Atp2c1 UTSW 9 105435140 missense probably benign 0.10
R4763:Atp2c1 UTSW 9 105418567 missense probably damaging 1.00
R4962:Atp2c1 UTSW 9 105442950 missense probably benign 0.03
R5121:Atp2c1 UTSW 9 105448825 missense probably damaging 1.00
R5458:Atp2c1 UTSW 9 105414725 nonsense probably null
R5551:Atp2c1 UTSW 9 105459737 missense probably damaging 1.00
R6198:Atp2c1 UTSW 9 105521072 missense probably benign 0.00
R6414:Atp2c1 UTSW 9 105466656 missense probably damaging 1.00
R6432:Atp2c1 UTSW 9 105445313 missense probably damaging 1.00
R6675:Atp2c1 UTSW 9 105453533 critical splice donor site probably null
R6719:Atp2c1 UTSW 9 105424178 missense probably damaging 1.00
R6777:Atp2c1 UTSW 9 105418600 missense possibly damaging 0.64
R6847:Atp2c1 UTSW 9 105418579 missense probably damaging 1.00
R6870:Atp2c1 UTSW 9 105470062 missense probably benign 0.13
X0053:Atp2c1 UTSW 9 105418684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACATGCCTTGCAGTGAAGAG -3'
(R):5'- ACTGCCATCAGGTCTCATCGCTAC -3'

Sequencing Primer
(F):5'- CCTTGCAGTGAAGAGTAAGTTACAC -3'
(R):5'- CCTCAGGTCACTGGAGTTG -3'
Posted On2014-04-24