Incidental Mutation 'R1611:Pde7b'
ID176803
Institutional Source Beutler Lab
Gene Symbol Pde7b
Ensembl Gene ENSMUSG00000019990
Gene Namephosphodiesterase 7B
Synonyms
MMRRC Submission 039648-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1611 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location20398004-20725078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20434490 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 242 (N242S)
Ref Sequence ENSEMBL: ENSMUSP00000126324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020165] [ENSMUST00000164195] [ENSMUST00000169016] [ENSMUST00000169404] [ENSMUST00000170265]
Predicted Effect probably benign
Transcript: ENSMUST00000020165
AA Change: N229S

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020165
Gene: ENSMUSG00000019990
AA Change: N229S

DomainStartEndE-ValueType
HDc 170 337 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164195
AA Change: N281S

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126913
Gene: ENSMUSG00000019990
AA Change: N281S

DomainStartEndE-ValueType
HDc 222 389 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169016
SMART Domains Protein: ENSMUSP00000130596
Gene: ENSMUSG00000019990

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169404
AA Change: N281S

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132378
Gene: ENSMUSG00000019990
AA Change: N281S

DomainStartEndE-ValueType
HDc 222 389 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170265
AA Change: N242S

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126324
Gene: ENSMUSG00000019990
AA Change: N242S

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
HDc 183 350 9.04e-7 SMART
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 3',5'-cyclic nucleotides cAMP and cGMP function as second messengers in a wide variety of signal transduction pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs) catalyze the hydrolysis of cAMP and cGMP to the corresponding 5'-monophosphates and provide a mechanism to downregulate cAMP and cGMP signaling. This gene encodes a cAMP-specific phosphodiesterase, a member of the cyclic nucleotide phosphodiesterase family.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G A 1: 136,216,117 P527L probably damaging Het
Acsl6 A T 11: 54,325,564 I186F possibly damaging Het
Actr6 T A 10: 89,732,202 K14* probably null Het
Adgrv1 A T 13: 81,559,117 V1390E probably damaging Het
Akap1 C T 11: 88,845,278 R186K probably benign Het
Alg10b T A 15: 90,225,781 V99D probably damaging Het
Atp2c1 C T 9: 105,442,852 G407S probably damaging Het
Atp9a T C 2: 168,673,569 M401V probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bclaf1 T C 10: 20,323,252 probably benign Het
Bcr T A 10: 75,125,202 probably null Het
Bivm T C 1: 44,126,747 I119T possibly damaging Het
Cacna1h A G 17: 25,381,471 I1632T probably damaging Het
Capn9 G A 8: 124,611,512 V537M possibly damaging Het
Cdk11b G A 4: 155,641,575 probably benign Het
Cdk18 T A 1: 132,122,375 I21F probably damaging Het
Cep85l T C 10: 53,348,681 T271A probably benign Het
Chrm5 T C 2: 112,479,187 N528S possibly damaging Het
Cpsf6 T A 10: 117,361,828 probably benign Het
Cpt1c T C 7: 44,960,112 T689A probably benign Het
D030068K23Rik T C 8: 109,249,303 Y64C unknown Het
Ddb1 T A 19: 10,612,888 C260S probably damaging Het
Ddb1 T A 19: 10,626,764 probably null Het
Ddx58 T C 4: 40,223,862 Y339C probably damaging Het
Depdc5 C A 5: 32,990,953 Q1478K probably damaging Het
Diaph1 A C 18: 37,900,702 M247R unknown Het
Dusp8 T C 7: 142,082,957 S299G probably benign Het
Erbb4 C A 1: 68,040,388 G1178C probably damaging Het
Exoc7 A T 11: 116,295,265 I370N possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm12353 T A 4: 19,631,843 Y27* probably null Het
Gnl1 C T 17: 35,987,549 T395I probably damaging Het
Hpse2 G A 19: 42,789,065 T554I probably damaging Het
Hsd17b11 T C 5: 104,009,899 I116V probably benign Het
Kif24 A T 4: 41,423,552 V233E probably benign Het
Klhl5 A G 5: 65,164,649 T673A probably benign Het
Kmt2c C A 5: 25,359,311 probably null Het
Lipg T C 18: 74,948,059 N317S possibly damaging Het
Lpin1 A T 12: 16,577,218 L109Q probably null Het
Lyst A G 13: 13,634,897 E384G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Muc4 C T 16: 32,750,986 T288I possibly damaging Het
Naa35 G T 13: 59,628,933 R574L probably benign Het
Ncor2 T C 5: 125,110,020 probably benign Het
Nedd9 T A 13: 41,316,930 D249V probably benign Het
Nsg1 T A 5: 38,138,716 K38* probably null Het
Nup155 T A 15: 8,130,160 D518E probably damaging Het
Olfr152 T A 2: 87,782,624 I28N probably benign Het
Ovol1 T A 19: 5,551,070 H231L probably damaging Het
Parg A G 14: 32,238,570 I586V probably damaging Het
Pias3 T A 3: 96,699,697 probably null Het
Pramef12 A T 4: 144,392,812 V395E probably benign Het
Ptprf A G 4: 118,236,233 V404A probably benign Het
Rnf145 T C 11: 44,551,798 L259P probably damaging Het
Rps6ka5 C G 12: 100,570,852 V540L possibly damaging Het
Ryr3 C T 2: 112,653,505 D3966N possibly damaging Het
Samd9l A T 6: 3,373,771 S1163R probably benign Het
Serpinb9g T C 13: 33,492,874 I213T possibly damaging Het
Sil1 A T 18: 35,269,088 V331E possibly damaging Het
Ski A G 4: 155,159,938 F410S probably damaging Het
Slc25a25 C T 2: 32,420,379 E123K probably damaging Het
Slfnl1 A G 4: 120,533,377 E75G probably benign Het
Sp1 T A 15: 102,430,935 I436N probably damaging Het
Taf4b A T 18: 14,844,469 E766V probably null Het
Tgfbr1 A G 4: 47,396,526 Y180C probably damaging Het
Ube4a T C 9: 44,956,737 probably benign Het
Vmn2r1 T A 3: 64,104,537 C606* probably null Het
Wdr63 T C 3: 146,095,358 Y115C probably damaging Het
Zfp341 C A 2: 154,645,703 H702Q probably damaging Het
Other mutations in Pde7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Pde7b APN 10 20619129 critical splice donor site probably null
IGL01312:Pde7b APN 10 20436194 critical splice donor site probably null
IGL01728:Pde7b APN 10 20434464 critical splice donor site probably null
IGL01868:Pde7b APN 10 20407165 nonsense probably null
PIT4431001:Pde7b UTSW 10 20400545 missense possibly damaging 0.77
R0241:Pde7b UTSW 10 20436216 missense probably damaging 1.00
R0241:Pde7b UTSW 10 20436216 missense probably damaging 1.00
R0505:Pde7b UTSW 10 20438746 missense probably damaging 1.00
R1386:Pde7b UTSW 10 20418801 missense probably damaging 1.00
R1518:Pde7b UTSW 10 20548121 missense probably damaging 1.00
R1539:Pde7b UTSW 10 20479686 missense possibly damaging 0.75
R1547:Pde7b UTSW 10 20434594 missense probably damaging 1.00
R1571:Pde7b UTSW 10 20413090 missense probably benign 0.05
R1722:Pde7b UTSW 10 20436244 missense probably damaging 1.00
R2275:Pde7b UTSW 10 20400419 makesense probably null
R4622:Pde7b UTSW 10 20418792 missense probably damaging 1.00
R4666:Pde7b UTSW 10 20438750 missense probably damaging 1.00
R4757:Pde7b UTSW 10 20547942 missense probably benign 0.01
R4823:Pde7b UTSW 10 20438785 missense probably damaging 1.00
R4889:Pde7b UTSW 10 20548077 missense probably benign 0.16
R4910:Pde7b UTSW 10 20724734 unclassified probably benign
R4923:Pde7b UTSW 10 20413127 missense probably damaging 0.98
R5349:Pde7b UTSW 10 20619186 missense probably damaging 0.99
R6258:Pde7b UTSW 10 20440800 missense possibly damaging 0.93
R6645:Pde7b UTSW 10 20610566 critical splice donor site probably null
R7000:Pde7b UTSW 10 20443292 missense probably damaging 1.00
R7510:Pde7b UTSW 10 20413015 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCTTAGCTTTCTTCAGGGGATAGCC -3'
(R):5'- CCAGCCATCATTATTGCCCACAGG -3'

Sequencing Primer
(F):5'- GGGATAGCCTGGCTCTAAATC -3'
(R):5'- CCACTGCAATGGTAAAGCTTATG -3'
Posted On2014-04-24