Incidental Mutation 'R1611:Cep85l'
ID176805
Institutional Source Beutler Lab
Gene Symbol Cep85l
Ensembl Gene ENSMUSG00000038594
Gene Namecentrosomal protein 85-like
SynonymsGm9766
MMRRC Submission 039648-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R1611 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location53273443-53379947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53348681 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 271 (T271A)
Ref Sequence ENSEMBL: ENSMUSP00000151909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046221] [ENSMUST00000095691] [ENSMUST00000163319] [ENSMUST00000218468] [ENSMUST00000219491] [ENSMUST00000219921] [ENSMUST00000220197] [ENSMUST00000220376] [ENSMUST00000220443]
Predicted Effect probably benign
Transcript: ENSMUST00000046221
SMART Domains Protein: ENSMUSP00000045709
Gene: ENSMUSG00000038583

DomainStartEndE-ValueType
Pfam:Phospholamban 1 52 2.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095691
AA Change: T169A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093356
Gene: ENSMUSG00000038594
AA Change: T169A

DomainStartEndE-ValueType
coiled coil region 442 578 N/A INTRINSIC
coiled coil region 600 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163319
SMART Domains Protein: ENSMUSP00000132743
Gene: ENSMUSG00000038583

DomainStartEndE-ValueType
Pfam:Phospholamban 1 52 2.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218351
Predicted Effect probably benign
Transcript: ENSMUST00000218468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218596
Predicted Effect probably benign
Transcript: ENSMUST00000219491
Predicted Effect probably benign
Transcript: ENSMUST00000219921
Predicted Effect probably benign
Transcript: ENSMUST00000220197
Predicted Effect probably benign
Transcript: ENSMUST00000220376
AA Change: T169A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220401
Predicted Effect probably benign
Transcript: ENSMUST00000220443
AA Change: T271A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified as a breast cancer antigen. Nothing more is known of its function at this time. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G A 1: 136,216,117 P527L probably damaging Het
Acsl6 A T 11: 54,325,564 I186F possibly damaging Het
Actr6 T A 10: 89,732,202 K14* probably null Het
Adgrv1 A T 13: 81,559,117 V1390E probably damaging Het
Akap1 C T 11: 88,845,278 R186K probably benign Het
Alg10b T A 15: 90,225,781 V99D probably damaging Het
Atp2c1 C T 9: 105,442,852 G407S probably damaging Het
Atp9a T C 2: 168,673,569 M401V probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bclaf1 T C 10: 20,323,252 probably benign Het
Bcr T A 10: 75,125,202 probably null Het
Bivm T C 1: 44,126,747 I119T possibly damaging Het
Cacna1h A G 17: 25,381,471 I1632T probably damaging Het
Capn9 G A 8: 124,611,512 V537M possibly damaging Het
Cdk11b G A 4: 155,641,575 probably benign Het
Cdk18 T A 1: 132,122,375 I21F probably damaging Het
Chrm5 T C 2: 112,479,187 N528S possibly damaging Het
Cpsf6 T A 10: 117,361,828 probably benign Het
Cpt1c T C 7: 44,960,112 T689A probably benign Het
D030068K23Rik T C 8: 109,249,303 Y64C unknown Het
Ddb1 T A 19: 10,612,888 C260S probably damaging Het
Ddb1 T A 19: 10,626,764 probably null Het
Ddx58 T C 4: 40,223,862 Y339C probably damaging Het
Depdc5 C A 5: 32,990,953 Q1478K probably damaging Het
Diaph1 A C 18: 37,900,702 M247R unknown Het
Dusp8 T C 7: 142,082,957 S299G probably benign Het
Erbb4 C A 1: 68,040,388 G1178C probably damaging Het
Exoc7 A T 11: 116,295,265 I370N possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm12353 T A 4: 19,631,843 Y27* probably null Het
Gnl1 C T 17: 35,987,549 T395I probably damaging Het
Hpse2 G A 19: 42,789,065 T554I probably damaging Het
Hsd17b11 T C 5: 104,009,899 I116V probably benign Het
Kif24 A T 4: 41,423,552 V233E probably benign Het
Klhl5 A G 5: 65,164,649 T673A probably benign Het
Kmt2c C A 5: 25,359,311 probably null Het
Lipg T C 18: 74,948,059 N317S possibly damaging Het
Lpin1 A T 12: 16,577,218 L109Q probably null Het
Lyst A G 13: 13,634,897 E384G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Muc4 C T 16: 32,750,986 T288I possibly damaging Het
Naa35 G T 13: 59,628,933 R574L probably benign Het
Ncor2 T C 5: 125,110,020 probably benign Het
Nedd9 T A 13: 41,316,930 D249V probably benign Het
Nsg1 T A 5: 38,138,716 K38* probably null Het
Nup155 T A 15: 8,130,160 D518E probably damaging Het
Olfr152 T A 2: 87,782,624 I28N probably benign Het
Ovol1 T A 19: 5,551,070 H231L probably damaging Het
Parg A G 14: 32,238,570 I586V probably damaging Het
Pde7b T C 10: 20,434,490 N242S probably benign Het
Pias3 T A 3: 96,699,697 probably null Het
Pramef12 A T 4: 144,392,812 V395E probably benign Het
Ptprf A G 4: 118,236,233 V404A probably benign Het
Rnf145 T C 11: 44,551,798 L259P probably damaging Het
Rps6ka5 C G 12: 100,570,852 V540L possibly damaging Het
Ryr3 C T 2: 112,653,505 D3966N possibly damaging Het
Samd9l A T 6: 3,373,771 S1163R probably benign Het
Serpinb9g T C 13: 33,492,874 I213T possibly damaging Het
Sil1 A T 18: 35,269,088 V331E possibly damaging Het
Ski A G 4: 155,159,938 F410S probably damaging Het
Slc25a25 C T 2: 32,420,379 E123K probably damaging Het
Slfnl1 A G 4: 120,533,377 E75G probably benign Het
Sp1 T A 15: 102,430,935 I436N probably damaging Het
Taf4b A T 18: 14,844,469 E766V probably null Het
Tgfbr1 A G 4: 47,396,526 Y180C probably damaging Het
Ube4a T C 9: 44,956,737 probably benign Het
Vmn2r1 T A 3: 64,104,537 C606* probably null Het
Wdr63 T C 3: 146,095,358 Y115C probably damaging Het
Zfp341 C A 2: 154,645,703 H702Q probably damaging Het
Other mutations in Cep85l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0103:Cep85l UTSW 10 53278174 missense possibly damaging 0.53
R0103:Cep85l UTSW 10 53278174 missense possibly damaging 0.53
R0559:Cep85l UTSW 10 53348501 missense probably benign 0.00
R0689:Cep85l UTSW 10 53348847 missense probably damaging 1.00
R0750:Cep85l UTSW 10 53281546 missense probably damaging 0.99
R0969:Cep85l UTSW 10 53281496 missense probably benign 0.00
R1375:Cep85l UTSW 10 53349258 missense probably damaging 0.99
R1542:Cep85l UTSW 10 53301584 missense probably damaging 1.00
R1749:Cep85l UTSW 10 53278154 missense probably damaging 1.00
R1826:Cep85l UTSW 10 53348812 missense possibly damaging 0.89
R2007:Cep85l UTSW 10 53278075 utr 3 prime probably benign
R2043:Cep85l UTSW 10 53358128 missense possibly damaging 0.64
R2144:Cep85l UTSW 10 53358126 missense probably benign 0.04
R2186:Cep85l UTSW 10 53348618 missense probably damaging 0.97
R2201:Cep85l UTSW 10 53348731 missense probably benign 0.01
R3767:Cep85l UTSW 10 53291810 missense probably benign 0.09
R5249:Cep85l UTSW 10 53319594 splice site probably null
R5764:Cep85l UTSW 10 53348994 missense probably benign 0.00
R6207:Cep85l UTSW 10 53281555 missense probably benign
R6333:Cep85l UTSW 10 53349101 nonsense probably null
R6422:Cep85l UTSW 10 53291780 missense possibly damaging 0.62
R6511:Cep85l UTSW 10 53278092 missense probably benign 0.00
R6645:Cep85l UTSW 10 53301672 missense probably benign 0.26
R6863:Cep85l UTSW 10 53349118 missense probably damaging 1.00
R6904:Cep85l UTSW 10 53349098 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTGTTGCCAAGGAGCTAAACTG -3'
(R):5'- AGGGCAAGCCTTTTATGTCCCAC -3'

Sequencing Primer
(F):5'- GAGCTAAACTGTAAGAATCGTCTGTG -3'
(R):5'- GGCCAAGTTGCTTACATGAC -3'
Posted On2014-04-24