Incidental Mutation 'R1611:Cpsf6'
ID176807
Institutional Source Beutler Lab
Gene Symbol Cpsf6
Ensembl Gene ENSMUSG00000055531
Gene Namecleavage and polyadenylation specific factor 6
SynonymsHPBRII-4, CFIM68, 4733401N12Rik, HPBRII-7
MMRRC Submission 039648-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R1611 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location117344673-117380015 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 117361828 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069168] [ENSMUST00000175924] [ENSMUST00000176480] [ENSMUST00000176670] [ENSMUST00000176686] [ENSMUST00000177145]
Predicted Effect probably benign
Transcript: ENSMUST00000069168
SMART Domains Protein: ENSMUSP00000068408
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175924
SMART Domains Protein: ENSMUSP00000135848
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
PDB:3Q2T|D 19 91 3e-48 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176480
SMART Domains Protein: ENSMUSP00000135550
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
low complexity region 6 30 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 119 182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176567
Predicted Effect unknown
Transcript: ENSMUST00000176670
AA Change: I251F
SMART Domains Protein: ENSMUSP00000135150
Gene: ENSMUSG00000055531
AA Change: I251F

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 232 N/A INTRINSIC
low complexity region 273 402 N/A INTRINSIC
low complexity region 413 437 N/A INTRINSIC
low complexity region 459 475 N/A INTRINSIC
low complexity region 526 588 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176686
SMART Domains Protein: ENSMUSP00000134823
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177145
SMART Domains Protein: ENSMUSP00000135136
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 551 N/A INTRINSIC
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. The cleavage factor complex is composed of four polypeptides. This gene encodes the 68kD subunit. It has a domain organization reminiscent of spliceosomal proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G A 1: 136,216,117 P527L probably damaging Het
Acsl6 A T 11: 54,325,564 I186F possibly damaging Het
Actr6 T A 10: 89,732,202 K14* probably null Het
Adgrv1 A T 13: 81,559,117 V1390E probably damaging Het
Akap1 C T 11: 88,845,278 R186K probably benign Het
Alg10b T A 15: 90,225,781 V99D probably damaging Het
Atp2c1 C T 9: 105,442,852 G407S probably damaging Het
Atp9a T C 2: 168,673,569 M401V probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bclaf1 T C 10: 20,323,252 probably benign Het
Bcr T A 10: 75,125,202 probably null Het
Bivm T C 1: 44,126,747 I119T possibly damaging Het
Cacna1h A G 17: 25,381,471 I1632T probably damaging Het
Capn9 G A 8: 124,611,512 V537M possibly damaging Het
Cdk11b G A 4: 155,641,575 probably benign Het
Cdk18 T A 1: 132,122,375 I21F probably damaging Het
Cep85l T C 10: 53,348,681 T271A probably benign Het
Chrm5 T C 2: 112,479,187 N528S possibly damaging Het
Cpt1c T C 7: 44,960,112 T689A probably benign Het
D030068K23Rik T C 8: 109,249,303 Y64C unknown Het
Ddb1 T A 19: 10,612,888 C260S probably damaging Het
Ddb1 T A 19: 10,626,764 probably null Het
Ddx58 T C 4: 40,223,862 Y339C probably damaging Het
Depdc5 C A 5: 32,990,953 Q1478K probably damaging Het
Diaph1 A C 18: 37,900,702 M247R unknown Het
Dusp8 T C 7: 142,082,957 S299G probably benign Het
Erbb4 C A 1: 68,040,388 G1178C probably damaging Het
Exoc7 A T 11: 116,295,265 I370N possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm12353 T A 4: 19,631,843 Y27* probably null Het
Gnl1 C T 17: 35,987,549 T395I probably damaging Het
Hpse2 G A 19: 42,789,065 T554I probably damaging Het
Hsd17b11 T C 5: 104,009,899 I116V probably benign Het
Kif24 A T 4: 41,423,552 V233E probably benign Het
Klhl5 A G 5: 65,164,649 T673A probably benign Het
Kmt2c C A 5: 25,359,311 probably null Het
Lipg T C 18: 74,948,059 N317S possibly damaging Het
Lpin1 A T 12: 16,577,218 L109Q probably null Het
Lyst A G 13: 13,634,897 E384G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Muc4 C T 16: 32,750,986 T288I possibly damaging Het
Naa35 G T 13: 59,628,933 R574L probably benign Het
Ncor2 T C 5: 125,110,020 probably benign Het
Nedd9 T A 13: 41,316,930 D249V probably benign Het
Nsg1 T A 5: 38,138,716 K38* probably null Het
Nup155 T A 15: 8,130,160 D518E probably damaging Het
Olfr152 T A 2: 87,782,624 I28N probably benign Het
Ovol1 T A 19: 5,551,070 H231L probably damaging Het
Parg A G 14: 32,238,570 I586V probably damaging Het
Pde7b T C 10: 20,434,490 N242S probably benign Het
Pias3 T A 3: 96,699,697 probably null Het
Pramef12 A T 4: 144,392,812 V395E probably benign Het
Ptprf A G 4: 118,236,233 V404A probably benign Het
Rnf145 T C 11: 44,551,798 L259P probably damaging Het
Rps6ka5 C G 12: 100,570,852 V540L possibly damaging Het
Ryr3 C T 2: 112,653,505 D3966N possibly damaging Het
Samd9l A T 6: 3,373,771 S1163R probably benign Het
Serpinb9g T C 13: 33,492,874 I213T possibly damaging Het
Sil1 A T 18: 35,269,088 V331E possibly damaging Het
Ski A G 4: 155,159,938 F410S probably damaging Het
Slc25a25 C T 2: 32,420,379 E123K probably damaging Het
Slfnl1 A G 4: 120,533,377 E75G probably benign Het
Sp1 T A 15: 102,430,935 I436N probably damaging Het
Taf4b A T 18: 14,844,469 E766V probably null Het
Tgfbr1 A G 4: 47,396,526 Y180C probably damaging Het
Ube4a T C 9: 44,956,737 probably benign Het
Vmn2r1 T A 3: 64,104,537 C606* probably null Het
Wdr63 T C 3: 146,095,358 Y115C probably damaging Het
Zfp341 C A 2: 154,645,703 H702Q probably damaging Het
Other mutations in Cpsf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Cpsf6 APN 10 117366129 unclassified probably benign
IGL03018:Cpsf6 APN 10 117367956 missense probably benign 0.02
IGL03392:Cpsf6 APN 10 117367979 missense probably damaging 1.00
R1006:Cpsf6 UTSW 10 117366068 splice site probably benign
R1239:Cpsf6 UTSW 10 117361343 unclassified probably benign
R2041:Cpsf6 UTSW 10 117359128 missense probably damaging 0.99
R2117:Cpsf6 UTSW 10 117366120 unclassified probably benign
R2225:Cpsf6 UTSW 10 117363036 unclassified probably benign
R4752:Cpsf6 UTSW 10 117361368 splice site probably benign
R5001:Cpsf6 UTSW 10 117367961 missense possibly damaging 0.71
R5176:Cpsf6 UTSW 10 117361284 unclassified probably benign
R5393:Cpsf6 UTSW 10 117362016 unclassified probably benign
R5696:Cpsf6 UTSW 10 117361029 unclassified probably benign
Z1088:Cpsf6 UTSW 10 117356041 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTTACAGTCTACTCTGATGCCAAGC -3'
(R):5'- GCAGCTACACAGTCAGGACAGATG -3'

Sequencing Primer
(F):5'- TCTACTCTGATGCCAAGCTAGAAAG -3'
(R):5'- TTCCTCAAGGTGGTAGAGGAC -3'
Posted On2014-04-24