Incidental Mutation 'R1611:Exoc7'
ID176812
Institutional Source Beutler Lab
Gene Symbol Exoc7
Ensembl Gene ENSMUSG00000020792
Gene Nameexocyst complex component 7
Synonymssec70, Exo70, 70kDa
MMRRC Submission 039648-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.771) question?
Stock #R1611 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116288001-116307233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116295265 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 370 (I370N)
Ref Sequence ENSEMBL: ENSMUSP00000102021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021147] [ENSMUST00000106411] [ENSMUST00000106413] [ENSMUST00000126731]
Predicted Effect probably benign
Transcript: ENSMUST00000021147
AA Change: I370N

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021147
Gene: ENSMUSG00000020792
AA Change: I370N

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 310 691 6.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106411
AA Change: I339N

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102019
Gene: ENSMUSG00000020792
AA Change: I339N

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 278 648 4e-82 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106413
AA Change: I370N

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102021
Gene: ENSMUSG00000020792
AA Change: I370N

DomainStartEndE-ValueType
coiled coil region 5 37 N/A INTRINSIC
low complexity region 177 191 N/A INTRINSIC
Pfam:Exo70 309 679 6.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126731
SMART Domains Protein: ENSMUSP00000121794
Gene: ENSMUSG00000020792

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
PDB:2PFT|A 78 265 1e-113 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155288
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex. The exocyst complex plays a critical role in vesicular trafficking and the secretory pathway by targeting post-Golgi vesicles to the plasma membrane. The encoded protein is required for assembly of the exocyst complex and docking of the complex to the plasma membrane. The encoded protein may also play a role in pre-mRNA splicing through interactions with pre-mRNA-processing factor 19. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G A 1: 136,216,117 P527L probably damaging Het
Acsl6 A T 11: 54,325,564 I186F possibly damaging Het
Actr6 T A 10: 89,732,202 K14* probably null Het
Adgrv1 A T 13: 81,559,117 V1390E probably damaging Het
Akap1 C T 11: 88,845,278 R186K probably benign Het
Alg10b T A 15: 90,225,781 V99D probably damaging Het
Atp2c1 C T 9: 105,442,852 G407S probably damaging Het
Atp9a T C 2: 168,673,569 M401V probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bclaf1 T C 10: 20,323,252 probably benign Het
Bcr T A 10: 75,125,202 probably null Het
Bivm T C 1: 44,126,747 I119T possibly damaging Het
Cacna1h A G 17: 25,381,471 I1632T probably damaging Het
Capn9 G A 8: 124,611,512 V537M possibly damaging Het
Cdk11b G A 4: 155,641,575 probably benign Het
Cdk18 T A 1: 132,122,375 I21F probably damaging Het
Cep85l T C 10: 53,348,681 T271A probably benign Het
Chrm5 T C 2: 112,479,187 N528S possibly damaging Het
Cpsf6 T A 10: 117,361,828 probably benign Het
Cpt1c T C 7: 44,960,112 T689A probably benign Het
D030068K23Rik T C 8: 109,249,303 Y64C unknown Het
Ddb1 T A 19: 10,612,888 C260S probably damaging Het
Ddb1 T A 19: 10,626,764 probably null Het
Ddx58 T C 4: 40,223,862 Y339C probably damaging Het
Depdc5 C A 5: 32,990,953 Q1478K probably damaging Het
Diaph1 A C 18: 37,900,702 M247R unknown Het
Dusp8 T C 7: 142,082,957 S299G probably benign Het
Erbb4 C A 1: 68,040,388 G1178C probably damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm12353 T A 4: 19,631,843 Y27* probably null Het
Gnl1 C T 17: 35,987,549 T395I probably damaging Het
Hpse2 G A 19: 42,789,065 T554I probably damaging Het
Hsd17b11 T C 5: 104,009,899 I116V probably benign Het
Kif24 A T 4: 41,423,552 V233E probably benign Het
Klhl5 A G 5: 65,164,649 T673A probably benign Het
Kmt2c C A 5: 25,359,311 probably null Het
Lipg T C 18: 74,948,059 N317S possibly damaging Het
Lpin1 A T 12: 16,577,218 L109Q probably null Het
Lyst A G 13: 13,634,897 E384G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Muc4 C T 16: 32,750,986 T288I possibly damaging Het
Naa35 G T 13: 59,628,933 R574L probably benign Het
Ncor2 T C 5: 125,110,020 probably benign Het
Nedd9 T A 13: 41,316,930 D249V probably benign Het
Nsg1 T A 5: 38,138,716 K38* probably null Het
Nup155 T A 15: 8,130,160 D518E probably damaging Het
Olfr152 T A 2: 87,782,624 I28N probably benign Het
Ovol1 T A 19: 5,551,070 H231L probably damaging Het
Parg A G 14: 32,238,570 I586V probably damaging Het
Pde7b T C 10: 20,434,490 N242S probably benign Het
Pias3 T A 3: 96,699,697 probably null Het
Pramef12 A T 4: 144,392,812 V395E probably benign Het
Ptprf A G 4: 118,236,233 V404A probably benign Het
Rnf145 T C 11: 44,551,798 L259P probably damaging Het
Rps6ka5 C G 12: 100,570,852 V540L possibly damaging Het
Ryr3 C T 2: 112,653,505 D3966N possibly damaging Het
Samd9l A T 6: 3,373,771 S1163R probably benign Het
Serpinb9g T C 13: 33,492,874 I213T possibly damaging Het
Sil1 A T 18: 35,269,088 V331E possibly damaging Het
Ski A G 4: 155,159,938 F410S probably damaging Het
Slc25a25 C T 2: 32,420,379 E123K probably damaging Het
Slfnl1 A G 4: 120,533,377 E75G probably benign Het
Sp1 T A 15: 102,430,935 I436N probably damaging Het
Taf4b A T 18: 14,844,469 E766V probably null Het
Tgfbr1 A G 4: 47,396,526 Y180C probably damaging Het
Ube4a T C 9: 44,956,737 probably benign Het
Vmn2r1 T A 3: 64,104,537 C606* probably null Het
Wdr63 T C 3: 146,095,358 Y115C probably damaging Het
Zfp341 C A 2: 154,645,703 H702Q probably damaging Het
Other mutations in Exoc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Exoc7 APN 11 116301100 splice site probably null
IGL02825:Exoc7 APN 11 116297585 missense probably damaging 0.98
IGL03068:Exoc7 APN 11 116301134 missense possibly damaging 0.70
IGL03333:Exoc7 APN 11 116301161 missense probably benign 0.17
IGL03412:Exoc7 APN 11 116289275 missense possibly damaging 0.57
IGL02799:Exoc7 UTSW 11 116301181 missense probably damaging 1.00
R0022:Exoc7 UTSW 11 116297582 missense possibly damaging 0.62
R0068:Exoc7 UTSW 11 116304906 missense probably damaging 1.00
R0158:Exoc7 UTSW 11 116295292 missense probably benign 0.01
R0362:Exoc7 UTSW 11 116295662 missense probably benign 0.37
R0387:Exoc7 UTSW 11 116294401 unclassified probably benign
R0394:Exoc7 UTSW 11 116300398 missense probably damaging 0.99
R0714:Exoc7 UTSW 11 116293294 missense probably benign 0.16
R0848:Exoc7 UTSW 11 116295248 missense possibly damaging 0.93
R1795:Exoc7 UTSW 11 116292521 missense probably damaging 0.98
R2259:Exoc7 UTSW 11 116306411 missense probably damaging 1.00
R3911:Exoc7 UTSW 11 116306905 missense probably benign 0.12
R3913:Exoc7 UTSW 11 116306905 missense probably benign 0.12
R3979:Exoc7 UTSW 11 116296762 missense probably benign 0.30
R4029:Exoc7 UTSW 11 116306988 unclassified probably benign
R4576:Exoc7 UTSW 11 116289183 makesense probably null
R4983:Exoc7 UTSW 11 116289269 missense probably damaging 1.00
R5309:Exoc7 UTSW 11 116305027 nonsense probably null
R6453:Exoc7 UTSW 11 116293969 splice site probably null
X0063:Exoc7 UTSW 11 116304949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCTTGACTTGTCCAAAGCCCC -3'
(R):5'- CACTGCCCCATGTAGCTGTTACTG -3'

Sequencing Primer
(F):5'- aagggacgctgtgtgtg -3'
(R):5'- AGCCTGTTGTCGCCCTAAG -3'
Posted On2014-04-24