Incidental Mutation 'R1611:Hpse2'
ID176835
Institutional Source Beutler Lab
Gene Symbol Hpse2
Ensembl Gene ENSMUSG00000074852
Gene Nameheparanase 2
SynonymsLOC381226
MMRRC Submission 039648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R1611 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location42788947-43388311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42789065 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 554 (T554I)
Ref Sequence ENSEMBL: ENSMUSP00000097026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099428]
Predicted Effect probably damaging
Transcript: ENSMUST00000099428
AA Change: T554I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097026
Gene: ENSMUSG00000074852
AA Change: T554I

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Glyco_hydro_79n 168 408 6.6e-22 PFAM
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heparanase enzyme. The encoded protein is a endoglycosidase that degrades heparin sulfate proteoglycans located on the extracellular matrix and cell surface. This protein may be involved in biological processes involving remodeling of the extracellular matrix including angiogenesis and tumor progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit growth retardation, a distended urinary bladder, abnormal voiding behavior, proteinuria, renal dysfunction and malnutrition, reduced cell proliferation, urinary bladder fibrosis, and lethality within one month of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G A 1: 136,216,117 P527L probably damaging Het
Acsl6 A T 11: 54,325,564 I186F possibly damaging Het
Actr6 T A 10: 89,732,202 K14* probably null Het
Adgrv1 A T 13: 81,559,117 V1390E probably damaging Het
Akap1 C T 11: 88,845,278 R186K probably benign Het
Alg10b T A 15: 90,225,781 V99D probably damaging Het
Atp2c1 C T 9: 105,442,852 G407S probably damaging Het
Atp9a T C 2: 168,673,569 M401V probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
Bclaf1 T C 10: 20,323,252 probably benign Het
Bcr T A 10: 75,125,202 probably null Het
Bivm T C 1: 44,126,747 I119T possibly damaging Het
Cacna1h A G 17: 25,381,471 I1632T probably damaging Het
Capn9 G A 8: 124,611,512 V537M possibly damaging Het
Cdk11b G A 4: 155,641,575 probably benign Het
Cdk18 T A 1: 132,122,375 I21F probably damaging Het
Cep85l T C 10: 53,348,681 T271A probably benign Het
Chrm5 T C 2: 112,479,187 N528S possibly damaging Het
Cpsf6 T A 10: 117,361,828 probably benign Het
Cpt1c T C 7: 44,960,112 T689A probably benign Het
D030068K23Rik T C 8: 109,249,303 Y64C unknown Het
Ddb1 T A 19: 10,612,888 C260S probably damaging Het
Ddb1 T A 19: 10,626,764 probably null Het
Ddx58 T C 4: 40,223,862 Y339C probably damaging Het
Depdc5 C A 5: 32,990,953 Q1478K probably damaging Het
Diaph1 A C 18: 37,900,702 M247R unknown Het
Dusp8 T C 7: 142,082,957 S299G probably benign Het
Erbb4 C A 1: 68,040,388 G1178C probably damaging Het
Exoc7 A T 11: 116,295,265 I370N possibly damaging Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Gm12353 T A 4: 19,631,843 Y27* probably null Het
Gnl1 C T 17: 35,987,549 T395I probably damaging Het
Hsd17b11 T C 5: 104,009,899 I116V probably benign Het
Kif24 A T 4: 41,423,552 V233E probably benign Het
Klhl5 A G 5: 65,164,649 T673A probably benign Het
Kmt2c C A 5: 25,359,311 probably null Het
Lipg T C 18: 74,948,059 N317S possibly damaging Het
Lpin1 A T 12: 16,577,218 L109Q probably null Het
Lyst A G 13: 13,634,897 E384G probably damaging Het
Micalcl T A 7: 112,381,464 I105N probably damaging Het
Muc4 C T 16: 32,750,986 T288I possibly damaging Het
Naa35 G T 13: 59,628,933 R574L probably benign Het
Ncor2 T C 5: 125,110,020 probably benign Het
Nedd9 T A 13: 41,316,930 D249V probably benign Het
Nsg1 T A 5: 38,138,716 K38* probably null Het
Nup155 T A 15: 8,130,160 D518E probably damaging Het
Olfr152 T A 2: 87,782,624 I28N probably benign Het
Ovol1 T A 19: 5,551,070 H231L probably damaging Het
Parg A G 14: 32,238,570 I586V probably damaging Het
Pde7b T C 10: 20,434,490 N242S probably benign Het
Pias3 T A 3: 96,699,697 probably null Het
Pramef12 A T 4: 144,392,812 V395E probably benign Het
Ptprf A G 4: 118,236,233 V404A probably benign Het
Rnf145 T C 11: 44,551,798 L259P probably damaging Het
Rps6ka5 C G 12: 100,570,852 V540L possibly damaging Het
Ryr3 C T 2: 112,653,505 D3966N possibly damaging Het
Samd9l A T 6: 3,373,771 S1163R probably benign Het
Serpinb9g T C 13: 33,492,874 I213T possibly damaging Het
Sil1 A T 18: 35,269,088 V331E possibly damaging Het
Ski A G 4: 155,159,938 F410S probably damaging Het
Slc25a25 C T 2: 32,420,379 E123K probably damaging Het
Slfnl1 A G 4: 120,533,377 E75G probably benign Het
Sp1 T A 15: 102,430,935 I436N probably damaging Het
Taf4b A T 18: 14,844,469 E766V probably null Het
Tgfbr1 A G 4: 47,396,526 Y180C probably damaging Het
Ube4a T C 9: 44,956,737 probably benign Het
Vmn2r1 T A 3: 64,104,537 C606* probably null Het
Wdr63 T C 3: 146,095,358 Y115C probably damaging Het
Zfp341 C A 2: 154,645,703 H702Q probably damaging Het
Other mutations in Hpse2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Hpse2 APN 19 43384789 missense probably benign
IGL02315:Hpse2 APN 19 42966947 splice site probably benign
IGL02324:Hpse2 APN 19 42931599 missense probably damaging 1.00
IGL02328:Hpse2 APN 19 42931599 missense probably damaging 1.00
IGL02388:Hpse2 APN 19 43294253 missense probably damaging 1.00
IGL02977:Hpse2 APN 19 42789122 splice site probably benign
R0147:Hpse2 UTSW 19 42931660 splice site probably null
R0148:Hpse2 UTSW 19 42931660 splice site probably null
R0472:Hpse2 UTSW 19 43013163 missense probably damaging 0.99
R0892:Hpse2 UTSW 19 43388146 missense probably benign 0.31
R1033:Hpse2 UTSW 19 42913199 missense probably benign 0.41
R1242:Hpse2 UTSW 19 42966977 missense probably benign 0.00
R1470:Hpse2 UTSW 19 43388253 missense probably benign 0.03
R1470:Hpse2 UTSW 19 43388253 missense probably benign 0.03
R2382:Hpse2 UTSW 19 42931622 missense probably benign 0.04
R2496:Hpse2 UTSW 19 43013043 critical splice donor site probably null
R2982:Hpse2 UTSW 19 43384743 missense probably null 0.99
R4056:Hpse2 UTSW 19 43294275 missense probably damaging 1.00
R4057:Hpse2 UTSW 19 43294275 missense probably damaging 1.00
R4434:Hpse2 UTSW 19 43294269 missense probably benign 0.00
R4762:Hpse2 UTSW 19 42789071 missense possibly damaging 0.52
R4856:Hpse2 UTSW 19 42788957 missense probably damaging 1.00
R4886:Hpse2 UTSW 19 43384764 missense probably damaging 1.00
R5018:Hpse2 UTSW 19 43384824 missense possibly damaging 0.57
R6289:Hpse2 UTSW 19 42788979 missense probably null 1.00
R6382:Hpse2 UTSW 19 43388202 missense possibly damaging 0.93
R6805:Hpse2 UTSW 19 43294321 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTTACGGACAGATGCCACCTAC -3'
(R):5'- ACCGGCTTTCTTGTTACTGCTACAG -3'

Sequencing Primer
(F):5'- AGCTCACACTATGACGGTTAG -3'
(R):5'- GTTACTGCTACAGTGCAAACATC -3'
Posted On2014-04-24