Incidental Mutation 'R1612:Adh7'
ID176850
Institutional Source Beutler Lab
Gene Symbol Adh7
Ensembl Gene ENSMUSG00000055301
Gene Namealcohol dehydrogenase 7 (class IV), mu or sigma polypeptide
SynonymsAdh3, Adh-3, Adh-3e, Adh3-e, Adh-3t, Adh3-t, Adh4, Adt-1, IV ADH
MMRRC Submission 039649-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R1612 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138217760-138233382 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138228881 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 355 (I355T)
Ref Sequence ENSEMBL: ENSMUSP00000087633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090171]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090171
AA Change: I355T

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087633
Gene: ENSMUSG00000055301
AA Change: I355T

DomainStartEndE-ValueType
Pfam:ADH_N 34 160 6.6e-27 PFAM
Pfam:ADH_zinc_N 202 337 2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196133
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes class IV alcohol dehydrogenase 7 mu or sigma subunit, which is a member of the alcohol dehydrogenase family. Members of this family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. The enzyme encoded by this gene is inefficient in ethanol oxidation, but is the most active as a retinol dehydrogenase; thus it may participate in the synthesis of retinoic acid, a hormone important for cellular differentiation. The expression of this gene is much more abundant in stomach than liver, thus differing from the other known gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in defective ethanol clearance and reduced metabolism of retinal to retinoic acid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
9930021J03Rik A G 19: 29,717,845 V1483A possibly damaging Het
Actb A G 5: 142,905,595 F31S probably damaging Het
Adamts7 T C 9: 90,188,697 S624P possibly damaging Het
Arhgef40 A G 14: 52,004,081 E106G probably damaging Het
Cabp7 T C 11: 4,739,198 D149G probably damaging Het
Cass4 A T 2: 172,427,078 Q362L possibly damaging Het
Cd14 G A 18: 36,725,665 Q246* probably null Het
Cdr2l A C 11: 115,393,406 E189D probably benign Het
Col6a6 A G 9: 105,777,549 V991A probably damaging Het
Coq7 A G 7: 118,509,911 W305R unknown Het
Cracr2a G T 6: 127,603,929 G23* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Epcam T C 17: 87,639,938 L40P possibly damaging Het
Eps8 G A 6: 137,500,618 P531S probably benign Het
Faap100 C A 11: 120,377,088 L286F probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbn2 A T 18: 58,061,752 C1446S probably damaging Het
Fmo3 A G 1: 162,967,885 V127A probably damaging Het
Frem3 A G 8: 80,614,861 D1261G probably damaging Het
Gabbr1 A G 17: 37,070,669 Y775C probably damaging Het
Gbp11 G T 5: 105,326,596 Q405K possibly damaging Het
Gdi2 T A 13: 3,560,051 V260E probably benign Het
Glp2r C T 11: 67,742,207 V98M possibly damaging Het
Gm13741 T C 2: 87,656,087 Y278C probably damaging Het
Gm7732 G A 17: 21,129,915 noncoding transcript Het
Gnptab T A 10: 88,428,482 probably null Het
Hbs1l T G 10: 21,358,835 F596V probably damaging Het
Krt78 A T 15: 101,951,844 probably null Het
Krt83 A T 15: 101,488,211 L223Q probably benign Het
Lcmt2 T C 2: 121,139,120 Y274C probably damaging Het
Limd1 A G 9: 123,518,154 Y620C probably damaging Het
Lvrn G T 18: 46,894,703 A862S probably damaging Het
Map4k2 A G 19: 6,343,341 E206G probably damaging Het
Med16 A G 10: 79,899,245 S461P probably damaging Het
Mrfap1 C A 5: 36,796,362 A78S probably damaging Het
Mum1 T A 10: 80,233,055 probably benign Het
Nav2 T A 7: 49,571,211 N1715K probably damaging Het
Ndc1 A G 4: 107,395,068 probably benign Het
Ngly1 G T 14: 16,290,867 G450* probably null Het
Olfr195 T C 16: 59,149,624 M258T probably benign Het
Olfr272 T A 4: 52,911,501 M98L probably benign Het
Pde3b T A 7: 114,519,556 Y643* probably null Het
Pdilt T G 7: 119,486,975 N506H possibly damaging Het
Pear1 C T 3: 87,751,853 probably null Het
Pfkp A T 13: 6,588,589 M582K probably damaging Het
Pigl T A 11: 62,512,994 F251I probably benign Het
Plk3 A G 4: 117,131,807 Y252H probably damaging Het
Prdx3 A G 19: 60,874,434 S12P possibly damaging Het
Prkag2 T C 5: 24,877,028 I96V probably benign Het
Rgs3 G A 4: 62,625,935 V146M probably damaging Het
Serpinh1 T C 7: 99,348,931 D164G probably damaging Het
Slc35d2 T C 13: 64,111,510 probably benign Het
Slc6a6 A G 6: 91,741,027 N316D probably damaging Het
Snx14 A T 9: 88,376,905 M973K possibly damaging Het
Sptan1 C G 2: 30,003,336 R1126G probably damaging Het
Stpg3 T C 2: 25,213,854 T157A probably benign Het
Tmem39b A T 4: 129,686,922 M259K possibly damaging Het
Tomm40l A T 1: 171,221,902 probably null Het
Tsen34 G T 7: 3,695,396 G180W probably damaging Het
Ube2l6 C T 2: 84,806,373 R54W probably damaging Het
Vdac1 A T 11: 52,384,070 T182S probably benign Het
Wdr3 T C 3: 100,151,199 probably benign Het
Wsb1 T A 11: 79,248,585 Q95L probably benign Het
Other mutations in Adh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Adh7 APN 3 138221734 missense probably benign 0.31
IGL01596:Adh7 APN 3 138226242 missense probably damaging 1.00
IGL01960:Adh7 APN 3 138226282 missense probably damaging 1.00
IGL02792:Adh7 APN 3 138223737 missense probably damaging 1.00
IGL03192:Adh7 APN 3 138227960 missense probably damaging 1.00
R1127:Adh7 UTSW 3 138221729 missense probably benign 0.01
R1539:Adh7 UTSW 3 138223955 missense possibly damaging 0.51
R1779:Adh7 UTSW 3 138223991 missense probably damaging 0.99
R3912:Adh7 UTSW 3 138221780 missense probably damaging 1.00
R3913:Adh7 UTSW 3 138221780 missense probably damaging 1.00
R5699:Adh7 UTSW 3 138226326 missense probably benign 0.00
R5765:Adh7 UTSW 3 138226329 missense probably benign 0.37
R6383:Adh7 UTSW 3 138228017 missense probably benign 0.09
R6520:Adh7 UTSW 3 138224010 missense probably damaging 1.00
R6883:Adh7 UTSW 3 138224064 missense probably damaging 1.00
R7081:Adh7 UTSW 3 138228845 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTTACTTAACAGAGCACAGAGAACA -3'
(R):5'- ATCCATCTGCTGTGGAACACTAAAGTC -3'

Sequencing Primer
(F):5'- AGAGCACAGAGAACAAACCTG -3'
(R):5'- ggaggtgggagtgagtgg -3'
Posted On2014-04-24