Incidental Mutation 'R1612:Tsen34'
ID176864
Institutional Source Beutler Lab
Gene Symbol Tsen34
Ensembl Gene ENSMUSG00000035585
Gene NametRNA splicing endonuclease subunit 34
SynonymsLeng5, 0610027F08Rik
MMRRC Submission 039649-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.777) question?
Stock #R1612 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location3692863-3701024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3695396 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 180 (G180W)
Ref Sequence ENSEMBL: ENSMUSP00000145965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038521] [ENSMUST00000038608] [ENSMUST00000108627] [ENSMUST00000108629] [ENSMUST00000108630] [ENSMUST00000118710] [ENSMUST00000123088] [ENSMUST00000127106] [ENSMUST00000128364] [ENSMUST00000137204] [ENSMUST00000142713] [ENSMUST00000155060] [ENSMUST00000205287] [ENSMUST00000205734] [ENSMUST00000206343] [ENSMUST00000206379] [ENSMUST00000206571]
Predicted Effect probably damaging
Transcript: ENSMUST00000038521
AA Change: G176W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046911
Gene: ENSMUSG00000035585
AA Change: G176W

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 219 303 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038608
SMART Domains Protein: ENSMUSP00000037107
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:MBOAT 57 420 2.4e-37 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108627
AA Change: G180W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104267
Gene: ENSMUSG00000035585
AA Change: G180W

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 4.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108629
AA Change: G180W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104269
Gene: ENSMUSG00000035585
AA Change: G180W

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 256 3.7e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108630
AA Change: G180W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104270
Gene: ENSMUSG00000035585
AA Change: G180W

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 7.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118710
SMART Domains Protein: ENSMUSP00000112710
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:MBOAT 86 343 1.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123088
SMART Domains Protein: ENSMUSP00000123614
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127106
SMART Domains Protein: ENSMUSP00000116446
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128364
SMART Domains Protein: ENSMUSP00000120521
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131688
Predicted Effect probably benign
Transcript: ENSMUST00000137204
SMART Domains Protein: ENSMUSP00000120403
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 69 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139396
Predicted Effect probably benign
Transcript: ENSMUST00000142713
SMART Domains Protein: ENSMUSP00000118440
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000147288
AA Change: G17W
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150785
Predicted Effect probably benign
Transcript: ENSMUST00000155060
SMART Domains Protein: ENSMUSP00000118816
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205287
AA Change: G180W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205644
Predicted Effect probably benign
Transcript: ENSMUST00000205734
Predicted Effect probably benign
Transcript: ENSMUST00000206343
Predicted Effect probably benign
Transcript: ENSMUST00000206379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206448
Predicted Effect probably benign
Transcript: ENSMUST00000206571
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a catalytic subunit of the tRNA splicing endonuclease, which catalyzes the removal of introns from precursor tRNAs. The endonuclease complex is also associated with a pre-mRNA 3-prime end processing factor. A mutation in this gene results in the neurological disorder pontocerebellar hypoplasia type 2. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
9930021J03Rik A G 19: 29,717,845 V1483A possibly damaging Het
Actb A G 5: 142,905,595 F31S probably damaging Het
Adamts7 T C 9: 90,188,697 S624P possibly damaging Het
Adh7 T C 3: 138,228,881 I355T possibly damaging Het
Arhgef40 A G 14: 52,004,081 E106G probably damaging Het
Cabp7 T C 11: 4,739,198 D149G probably damaging Het
Cass4 A T 2: 172,427,078 Q362L possibly damaging Het
Cd14 G A 18: 36,725,665 Q246* probably null Het
Cdr2l A C 11: 115,393,406 E189D probably benign Het
Col6a6 A G 9: 105,777,549 V991A probably damaging Het
Coq7 A G 7: 118,509,911 W305R unknown Het
Cracr2a G T 6: 127,603,929 G23* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Epcam T C 17: 87,639,938 L40P possibly damaging Het
Eps8 G A 6: 137,500,618 P531S probably benign Het
Faap100 C A 11: 120,377,088 L286F probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbn2 A T 18: 58,061,752 C1446S probably damaging Het
Fmo3 A G 1: 162,967,885 V127A probably damaging Het
Frem3 A G 8: 80,614,861 D1261G probably damaging Het
Gabbr1 A G 17: 37,070,669 Y775C probably damaging Het
Gbp11 G T 5: 105,326,596 Q405K possibly damaging Het
Gdi2 T A 13: 3,560,051 V260E probably benign Het
Glp2r C T 11: 67,742,207 V98M possibly damaging Het
Gm13741 T C 2: 87,656,087 Y278C probably damaging Het
Gm7732 G A 17: 21,129,915 noncoding transcript Het
Gnptab T A 10: 88,428,482 probably null Het
Hbs1l T G 10: 21,358,835 F596V probably damaging Het
Krt78 A T 15: 101,951,844 probably null Het
Krt83 A T 15: 101,488,211 L223Q probably benign Het
Lcmt2 T C 2: 121,139,120 Y274C probably damaging Het
Limd1 A G 9: 123,518,154 Y620C probably damaging Het
Lvrn G T 18: 46,894,703 A862S probably damaging Het
Map4k2 A G 19: 6,343,341 E206G probably damaging Het
Med16 A G 10: 79,899,245 S461P probably damaging Het
Mrfap1 C A 5: 36,796,362 A78S probably damaging Het
Mum1 T A 10: 80,233,055 probably benign Het
Nav2 T A 7: 49,571,211 N1715K probably damaging Het
Ndc1 A G 4: 107,395,068 probably benign Het
Ngly1 G T 14: 16,290,867 G450* probably null Het
Olfr195 T C 16: 59,149,624 M258T probably benign Het
Olfr272 T A 4: 52,911,501 M98L probably benign Het
Pde3b T A 7: 114,519,556 Y643* probably null Het
Pdilt T G 7: 119,486,975 N506H possibly damaging Het
Pear1 C T 3: 87,751,853 probably null Het
Pfkp A T 13: 6,588,589 M582K probably damaging Het
Pigl T A 11: 62,512,994 F251I probably benign Het
Plk3 A G 4: 117,131,807 Y252H probably damaging Het
Prdx3 A G 19: 60,874,434 S12P possibly damaging Het
Prkag2 T C 5: 24,877,028 I96V probably benign Het
Rgs3 G A 4: 62,625,935 V146M probably damaging Het
Serpinh1 T C 7: 99,348,931 D164G probably damaging Het
Slc35d2 T C 13: 64,111,510 probably benign Het
Slc6a6 A G 6: 91,741,027 N316D probably damaging Het
Snx14 A T 9: 88,376,905 M973K possibly damaging Het
Sptan1 C G 2: 30,003,336 R1126G probably damaging Het
Stpg3 T C 2: 25,213,854 T157A probably benign Het
Tmem39b A T 4: 129,686,922 M259K possibly damaging Het
Tomm40l A T 1: 171,221,902 probably null Het
Ube2l6 C T 2: 84,806,373 R54W probably damaging Het
Vdac1 A T 11: 52,384,070 T182S probably benign Het
Wdr3 T C 3: 100,151,199 probably benign Het
Wsb1 T A 11: 79,248,585 Q95L probably benign Het
Other mutations in Tsen34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Tsen34 APN 7 3700531 makesense probably null
R2441:Tsen34 UTSW 7 3694995 missense possibly damaging 0.92
R4455:Tsen34 UTSW 7 3695098 unclassified probably null
R4702:Tsen34 UTSW 7 3700633 missense probably damaging 1.00
R4870:Tsen34 UTSW 7 3694381 unclassified probably benign
R5950:Tsen34 UTSW 7 3694788 missense probably null 0.97
R6221:Tsen34 UTSW 7 3695544 missense probably damaging 0.99
R6266:Tsen34 UTSW 7 3693985 unclassified probably benign
R7121:Tsen34 UTSW 7 3694987 missense probably benign 0.18
R7134:Tsen34 UTSW 7 3700641 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTCAAACGCCAGCAAGAGCAG -3'
(R):5'- TGAGGAAGAAACCTCTCTCCCACAG -3'

Sequencing Primer
(F):5'- TCCAGGATCAGAACACTTTGGC -3'
(R):5'- TCCCACAGGTCTCGGTAGATG -3'
Posted On2014-04-24