Incidental Mutation 'R1612:Frem3'
ID176871
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission 039649-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1612 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80614861 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1261 (D1261G)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably damaging
Transcript: ENSMUST00000039695
AA Change: D1261G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: D1261G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Meta Mutation Damage Score 0.298 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
9930021J03Rik A G 19: 29,717,845 V1483A possibly damaging Het
Actb A G 5: 142,905,595 F31S probably damaging Het
Adamts7 T C 9: 90,188,697 S624P possibly damaging Het
Adh7 T C 3: 138,228,881 I355T possibly damaging Het
Arhgef40 A G 14: 52,004,081 E106G probably damaging Het
Cabp7 T C 11: 4,739,198 D149G probably damaging Het
Cass4 A T 2: 172,427,078 Q362L possibly damaging Het
Cd14 G A 18: 36,725,665 Q246* probably null Het
Cdr2l A C 11: 115,393,406 E189D probably benign Het
Col6a6 A G 9: 105,777,549 V991A probably damaging Het
Coq7 A G 7: 118,509,911 W305R unknown Het
Cracr2a G T 6: 127,603,929 G23* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Epcam T C 17: 87,639,938 L40P possibly damaging Het
Eps8 G A 6: 137,500,618 P531S probably benign Het
Faap100 C A 11: 120,377,088 L286F probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbn2 A T 18: 58,061,752 C1446S probably damaging Het
Fmo3 A G 1: 162,967,885 V127A probably damaging Het
Gabbr1 A G 17: 37,070,669 Y775C probably damaging Het
Gbp11 G T 5: 105,326,596 Q405K possibly damaging Het
Gdi2 T A 13: 3,560,051 V260E probably benign Het
Glp2r C T 11: 67,742,207 V98M possibly damaging Het
Gm13741 T C 2: 87,656,087 Y278C probably damaging Het
Gm7732 G A 17: 21,129,915 noncoding transcript Het
Gnptab T A 10: 88,428,482 probably null Het
Hbs1l T G 10: 21,358,835 F596V probably damaging Het
Krt78 A T 15: 101,951,844 probably null Het
Krt83 A T 15: 101,488,211 L223Q probably benign Het
Lcmt2 T C 2: 121,139,120 Y274C probably damaging Het
Limd1 A G 9: 123,518,154 Y620C probably damaging Het
Lvrn G T 18: 46,894,703 A862S probably damaging Het
Map4k2 A G 19: 6,343,341 E206G probably damaging Het
Med16 A G 10: 79,899,245 S461P probably damaging Het
Mrfap1 C A 5: 36,796,362 A78S probably damaging Het
Mum1 T A 10: 80,233,055 probably benign Het
Nav2 T A 7: 49,571,211 N1715K probably damaging Het
Ndc1 A G 4: 107,395,068 probably benign Het
Ngly1 G T 14: 16,290,867 G450* probably null Het
Olfr195 T C 16: 59,149,624 M258T probably benign Het
Olfr272 T A 4: 52,911,501 M98L probably benign Het
Pde3b T A 7: 114,519,556 Y643* probably null Het
Pdilt T G 7: 119,486,975 N506H possibly damaging Het
Pear1 C T 3: 87,751,853 probably null Het
Pfkp A T 13: 6,588,589 M582K probably damaging Het
Pigl T A 11: 62,512,994 F251I probably benign Het
Plk3 A G 4: 117,131,807 Y252H probably damaging Het
Prdx3 A G 19: 60,874,434 S12P possibly damaging Het
Prkag2 T C 5: 24,877,028 I96V probably benign Het
Rgs3 G A 4: 62,625,935 V146M probably damaging Het
Serpinh1 T C 7: 99,348,931 D164G probably damaging Het
Slc35d2 T C 13: 64,111,510 probably benign Het
Slc6a6 A G 6: 91,741,027 N316D probably damaging Het
Snx14 A T 9: 88,376,905 M973K possibly damaging Het
Sptan1 C G 2: 30,003,336 R1126G probably damaging Het
Stpg3 T C 2: 25,213,854 T157A probably benign Het
Tmem39b A T 4: 129,686,922 M259K possibly damaging Het
Tomm40l A T 1: 171,221,902 probably null Het
Tsen34 G T 7: 3,695,396 G180W probably damaging Het
Ube2l6 C T 2: 84,806,373 R54W probably damaging Het
Vdac1 A T 11: 52,384,070 T182S probably benign Het
Wdr3 T C 3: 100,151,199 probably benign Het
Wsb1 T A 11: 79,248,585 Q95L probably benign Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 intron probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGATGAGCAGCCTCAACTTTTCACC -3'
(R):5'- TCCCTGGCCTGTGTGGATATAATGG -3'

Sequencing Primer
(F):5'- GGGTCATAGACACCTCACTG -3'
(R):5'- CTGGGTGAAATTCATTCCCACAG -3'
Posted On2014-04-24