Incidental Mutation 'R1612:Med16'
ID176877
Institutional Source Beutler Lab
Gene Symbol Med16
Ensembl Gene ENSMUSG00000013833
Gene Namemediator complex subunit 16
SynonymsTrap95, 95kDa, Thrap5
MMRRC Submission 039649-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R1612 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79894708-79908923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79899245 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 461 (S461P)
Ref Sequence ENSEMBL: ENSMUSP00000129375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105378] [ENSMUST00000164705] [ENSMUST00000165684] [ENSMUST00000166964] [ENSMUST00000170409]
Predicted Effect probably damaging
Transcript: ENSMUST00000105378
AA Change: S460P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101017
Gene: ENSMUSG00000013833
AA Change: S460P

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
WD40 94 133 1.05e-7 SMART
Blast:WD40 143 169 4e-8 BLAST
low complexity region 206 217 N/A INTRINSIC
WD40 226 267 1.53e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163125
Predicted Effect probably benign
Transcript: ENSMUST00000164705
SMART Domains Protein: ENSMUSP00000129229
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 172 6.5e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165684
AA Change: S461P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129375
Gene: ENSMUSG00000013833
AA Change: S461P

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
WD40 95 134 1.05e-7 SMART
Blast:WD40 144 170 4e-8 BLAST
low complexity region 207 218 N/A INTRINSIC
WD40 227 268 1.53e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166964
SMART Domains Protein: ENSMUSP00000128463
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 59 98 1.05e-7 SMART
Pfam:Med16 108 162 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170375
Predicted Effect probably benign
Transcript: ENSMUST00000170409
SMART Domains Protein: ENSMUSP00000126729
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 105 1.1e-9 PFAM
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
9930021J03Rik A G 19: 29,717,845 V1483A possibly damaging Het
Actb A G 5: 142,905,595 F31S probably damaging Het
Adamts7 T C 9: 90,188,697 S624P possibly damaging Het
Adh7 T C 3: 138,228,881 I355T possibly damaging Het
Arhgef40 A G 14: 52,004,081 E106G probably damaging Het
Cabp7 T C 11: 4,739,198 D149G probably damaging Het
Cass4 A T 2: 172,427,078 Q362L possibly damaging Het
Cd14 G A 18: 36,725,665 Q246* probably null Het
Cdr2l A C 11: 115,393,406 E189D probably benign Het
Col6a6 A G 9: 105,777,549 V991A probably damaging Het
Coq7 A G 7: 118,509,911 W305R unknown Het
Cracr2a G T 6: 127,603,929 G23* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Epcam T C 17: 87,639,938 L40P possibly damaging Het
Eps8 G A 6: 137,500,618 P531S probably benign Het
Faap100 C A 11: 120,377,088 L286F probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbn2 A T 18: 58,061,752 C1446S probably damaging Het
Fmo3 A G 1: 162,967,885 V127A probably damaging Het
Frem3 A G 8: 80,614,861 D1261G probably damaging Het
Gabbr1 A G 17: 37,070,669 Y775C probably damaging Het
Gbp11 G T 5: 105,326,596 Q405K possibly damaging Het
Gdi2 T A 13: 3,560,051 V260E probably benign Het
Glp2r C T 11: 67,742,207 V98M possibly damaging Het
Gm13741 T C 2: 87,656,087 Y278C probably damaging Het
Gm7732 G A 17: 21,129,915 noncoding transcript Het
Gnptab T A 10: 88,428,482 probably null Het
Hbs1l T G 10: 21,358,835 F596V probably damaging Het
Krt78 A T 15: 101,951,844 probably null Het
Krt83 A T 15: 101,488,211 L223Q probably benign Het
Lcmt2 T C 2: 121,139,120 Y274C probably damaging Het
Limd1 A G 9: 123,518,154 Y620C probably damaging Het
Lvrn G T 18: 46,894,703 A862S probably damaging Het
Map4k2 A G 19: 6,343,341 E206G probably damaging Het
Mrfap1 C A 5: 36,796,362 A78S probably damaging Het
Mum1 T A 10: 80,233,055 probably benign Het
Nav2 T A 7: 49,571,211 N1715K probably damaging Het
Ndc1 A G 4: 107,395,068 probably benign Het
Ngly1 G T 14: 16,290,867 G450* probably null Het
Olfr195 T C 16: 59,149,624 M258T probably benign Het
Olfr272 T A 4: 52,911,501 M98L probably benign Het
Pde3b T A 7: 114,519,556 Y643* probably null Het
Pdilt T G 7: 119,486,975 N506H possibly damaging Het
Pear1 C T 3: 87,751,853 probably null Het
Pfkp A T 13: 6,588,589 M582K probably damaging Het
Pigl T A 11: 62,512,994 F251I probably benign Het
Plk3 A G 4: 117,131,807 Y252H probably damaging Het
Prdx3 A G 19: 60,874,434 S12P possibly damaging Het
Prkag2 T C 5: 24,877,028 I96V probably benign Het
Rgs3 G A 4: 62,625,935 V146M probably damaging Het
Serpinh1 T C 7: 99,348,931 D164G probably damaging Het
Slc35d2 T C 13: 64,111,510 probably benign Het
Slc6a6 A G 6: 91,741,027 N316D probably damaging Het
Snx14 A T 9: 88,376,905 M973K possibly damaging Het
Sptan1 C G 2: 30,003,336 R1126G probably damaging Het
Stpg3 T C 2: 25,213,854 T157A probably benign Het
Tmem39b A T 4: 129,686,922 M259K possibly damaging Het
Tomm40l A T 1: 171,221,902 probably null Het
Tsen34 G T 7: 3,695,396 G180W probably damaging Het
Ube2l6 C T 2: 84,806,373 R54W probably damaging Het
Vdac1 A T 11: 52,384,070 T182S probably benign Het
Wdr3 T C 3: 100,151,199 probably benign Het
Wsb1 T A 11: 79,248,585 Q95L probably benign Het
Other mutations in Med16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Med16 APN 10 79907625 start codon destroyed probably null 0.62
IGL02328:Med16 APN 10 79907542 missense probably damaging 1.00
IGL03123:Med16 APN 10 79896833 missense probably damaging 1.00
R0139:Med16 UTSW 10 79896801 missense probably benign 0.17
R0254:Med16 UTSW 10 79900200 missense possibly damaging 0.94
R1458:Med16 UTSW 10 79907478 unclassified probably benign
R1483:Med16 UTSW 10 79903100 missense possibly damaging 0.88
R1524:Med16 UTSW 10 79898316 missense probably damaging 1.00
R1700:Med16 UTSW 10 79899335 missense probably benign 0.10
R1900:Med16 UTSW 10 79898931 missense probably damaging 1.00
R1960:Med16 UTSW 10 79907095 missense possibly damaging 0.94
R2120:Med16 UTSW 10 79903082 missense possibly damaging 0.63
R2895:Med16 UTSW 10 79903171 unclassified probably null
R4419:Med16 UTSW 10 79898382 missense probably benign
R4794:Med16 UTSW 10 79900117 missense probably damaging 1.00
R4970:Med16 UTSW 10 79907037 critical splice donor site probably null
R4975:Med16 UTSW 10 79903005 missense possibly damaging 0.93
R5724:Med16 UTSW 10 79895409 missense probably damaging 1.00
R5926:Med16 UTSW 10 79902528 missense probably damaging 0.99
R6185:Med16 UTSW 10 79896363 missense probably damaging 1.00
R7097:Med16 UTSW 10 79903343 missense not run
Predicted Primers PCR Primer
(F):5'- TGCAGTATTCCAGCAGGAAAAGCAG -3'
(R):5'- TGTCAGTCAAGTGCCTTCTCCAGC -3'

Sequencing Primer
(F):5'- CTTGGGCTCCAGTGGGTG -3'
(R):5'- ATATTCTGCGAGGGAACCCG -3'
Posted On2014-04-24