Incidental Mutation 'R1612:Ngly1'
ID176890
Institutional Source Beutler Lab
Gene Symbol Ngly1
Ensembl Gene ENSMUSG00000021785
Gene NameN-glycanase 1
SynonymsPng1, PNGase, 1110002C09Rik
MMRRC Submission 039649-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock #R1612 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location16249280-16311926 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 16290867 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 450 (G450*)
Ref Sequence ENSEMBL: ENSMUSP00000022310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022310] [ENSMUST00000224656]
PDB Structure
Solution structure of the N-terminal portion of the PUB domain of mouse peptide:N-glycanase [SOLUTION NMR]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
Crystal structure of intein-tagged mouse PNGase C-terminal domain [X-RAY DIFFRACTION]
Crystal structure of His-tagged mouse PNGase C-terminal domain [X-RAY DIFFRACTION]
Crystal structure of the PUB domain of mouse PNGase [X-RAY DIFFRACTION]
Crystal structure of the mouse p97/PNGase complex [X-RAY DIFFRACTION]
Crystal structure of mouse Peptide N-Glycanase C-terminal domain in complex with mannopentaose [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000022310
AA Change: G450*
SMART Domains Protein: ENSMUSP00000022310
Gene: ENSMUSG00000021785
AA Change: G450*

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
PUG 30 91 1.83e-22 SMART
TGc 298 353 6.19e-14 SMART
Blast:PAW 376 415 2e-15 BLAST
low complexity region 416 433 N/A INTRINSIC
Blast:PAW 434 472 3e-15 BLAST
PAW 484 576 1.05e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224656
Meta Mutation Damage Score 0.556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes hydrolysis of an N(4)-(acetyl-beta-D-glucosaminyl) asparagine residue to N-acetyl-beta-D-glucosaminylamine and a peptide containing an aspartate residue. The encoded enzyme may play a role in the proteasome-mediated degradation of misfolded glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysregulation of the endoplasmic reticulum (ER)-associated degradation (ERAD) process. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
9930021J03Rik A G 19: 29,717,845 V1483A possibly damaging Het
Actb A G 5: 142,905,595 F31S probably damaging Het
Adamts7 T C 9: 90,188,697 S624P possibly damaging Het
Adh7 T C 3: 138,228,881 I355T possibly damaging Het
Arhgef40 A G 14: 52,004,081 E106G probably damaging Het
Cabp7 T C 11: 4,739,198 D149G probably damaging Het
Cass4 A T 2: 172,427,078 Q362L possibly damaging Het
Cd14 G A 18: 36,725,665 Q246* probably null Het
Cdr2l A C 11: 115,393,406 E189D probably benign Het
Col6a6 A G 9: 105,777,549 V991A probably damaging Het
Coq7 A G 7: 118,509,911 W305R unknown Het
Cracr2a G T 6: 127,603,929 G23* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Epcam T C 17: 87,639,938 L40P possibly damaging Het
Eps8 G A 6: 137,500,618 P531S probably benign Het
Faap100 C A 11: 120,377,088 L286F probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbn2 A T 18: 58,061,752 C1446S probably damaging Het
Fmo3 A G 1: 162,967,885 V127A probably damaging Het
Frem3 A G 8: 80,614,861 D1261G probably damaging Het
Gabbr1 A G 17: 37,070,669 Y775C probably damaging Het
Gbp11 G T 5: 105,326,596 Q405K possibly damaging Het
Gdi2 T A 13: 3,560,051 V260E probably benign Het
Glp2r C T 11: 67,742,207 V98M possibly damaging Het
Gm13741 T C 2: 87,656,087 Y278C probably damaging Het
Gm7732 G A 17: 21,129,915 noncoding transcript Het
Gnptab T A 10: 88,428,482 probably null Het
Hbs1l T G 10: 21,358,835 F596V probably damaging Het
Krt78 A T 15: 101,951,844 probably null Het
Krt83 A T 15: 101,488,211 L223Q probably benign Het
Lcmt2 T C 2: 121,139,120 Y274C probably damaging Het
Limd1 A G 9: 123,518,154 Y620C probably damaging Het
Lvrn G T 18: 46,894,703 A862S probably damaging Het
Map4k2 A G 19: 6,343,341 E206G probably damaging Het
Med16 A G 10: 79,899,245 S461P probably damaging Het
Mrfap1 C A 5: 36,796,362 A78S probably damaging Het
Mum1 T A 10: 80,233,055 probably benign Het
Nav2 T A 7: 49,571,211 N1715K probably damaging Het
Ndc1 A G 4: 107,395,068 probably benign Het
Olfr195 T C 16: 59,149,624 M258T probably benign Het
Olfr272 T A 4: 52,911,501 M98L probably benign Het
Pde3b T A 7: 114,519,556 Y643* probably null Het
Pdilt T G 7: 119,486,975 N506H possibly damaging Het
Pear1 C T 3: 87,751,853 probably null Het
Pfkp A T 13: 6,588,589 M582K probably damaging Het
Pigl T A 11: 62,512,994 F251I probably benign Het
Plk3 A G 4: 117,131,807 Y252H probably damaging Het
Prdx3 A G 19: 60,874,434 S12P possibly damaging Het
Prkag2 T C 5: 24,877,028 I96V probably benign Het
Rgs3 G A 4: 62,625,935 V146M probably damaging Het
Serpinh1 T C 7: 99,348,931 D164G probably damaging Het
Slc35d2 T C 13: 64,111,510 probably benign Het
Slc6a6 A G 6: 91,741,027 N316D probably damaging Het
Snx14 A T 9: 88,376,905 M973K possibly damaging Het
Sptan1 C G 2: 30,003,336 R1126G probably damaging Het
Stpg3 T C 2: 25,213,854 T157A probably benign Het
Tmem39b A T 4: 129,686,922 M259K possibly damaging Het
Tomm40l A T 1: 171,221,902 probably null Het
Tsen34 G T 7: 3,695,396 G180W probably damaging Het
Ube2l6 C T 2: 84,806,373 R54W probably damaging Het
Vdac1 A T 11: 52,384,070 T182S probably benign Het
Wdr3 T C 3: 100,151,199 probably benign Het
Wsb1 T A 11: 79,248,585 Q95L probably benign Het
Other mutations in Ngly1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Ngly1 APN 14 16290873 missense probably benign 0.14
IGL02199:Ngly1 APN 14 16290844 missense probably damaging 0.96
IGL02809:Ngly1 APN 14 16281791 missense probably damaging 1.00
IGL02865:Ngly1 APN 14 16290939 intron probably benign
IGL03209:Ngly1 APN 14 16281831 nonsense probably null
IGL03290:Ngly1 APN 14 16281866 missense probably damaging 0.98
IGL02799:Ngly1 UTSW 14 16260636 missense probably benign
R0518:Ngly1 UTSW 14 16290774 nonsense probably null
R0521:Ngly1 UTSW 14 16290774 nonsense probably null
R1851:Ngly1 UTSW 14 16260585 missense probably damaging 1.00
R2060:Ngly1 UTSW 14 16277877 missense possibly damaging 0.72
R2424:Ngly1 UTSW 14 16290721 intron probably null
R2696:Ngly1 UTSW 14 16283439 missense possibly damaging 0.52
R3834:Ngly1 UTSW 14 16290766 intron probably benign
R3883:Ngly1 UTSW 14 16270574 missense probably damaging 1.00
R4700:Ngly1 UTSW 14 16281809 missense probably benign 0.01
R5160:Ngly1 UTSW 14 16281751 missense probably damaging 0.98
R5555:Ngly1 UTSW 14 16270508 nonsense probably null
R5603:Ngly1 UTSW 14 16260762 missense probably benign 0.01
R5764:Ngly1 UTSW 14 16260799 missense probably benign
R5980:Ngly1 UTSW 14 16270509 missense possibly damaging 0.85
R6066:Ngly1 UTSW 14 16294634 missense probably benign 0.01
R6887:Ngly1 UTSW 14 16281836 missense probably benign 0.02
R6943:Ngly1 UTSW 14 16283467 missense probably damaging 1.00
R7101:Ngly1 UTSW 14 16283445 missense probably damaging 1.00
X0053:Ngly1 UTSW 14 16254743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGCCCATTTTAAAGCTGCAATAATC -3'
(R):5'- TCTCCCAGGAAGAAAACTCTCATCACCT -3'

Sequencing Primer
(F):5'- CTGCAATAATCCAGGTCATGAG -3'
(R):5'- TAGGACTTCGGCCCACAC -3'
Posted On2014-04-24