Incidental Mutation 'R1612:Gabbr1'
ID176896
Institutional Source Beutler Lab
Gene Symbol Gabbr1
Ensembl Gene ENSMUSG00000024462
Gene Namegamma-aminobutyric acid (GABA) B receptor, 1
SynonymsGABAB1, GABAbR1
MMRRC Submission 039649-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R1612 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37045966-37075067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37070669 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 775 (Y775C)
Ref Sequence ENSEMBL: ENSMUSP00000025338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025338] [ENSMUST00000172792] [ENSMUST00000173823]
Predicted Effect probably damaging
Transcript: ENSMUST00000025338
AA Change: Y775C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025338
Gene: ENSMUSG00000024462
AA Change: Y775C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 29 95 8.72e0 SMART
CCP 99 156 3.03e-10 SMART
Pfam:Peripla_BP_6 168 538 1.6e-23 PFAM
Pfam:ANF_receptor 186 542 4.3e-73 PFAM
Pfam:7tm_3 602 858 9.8e-49 PFAM
coiled coil region 877 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172792
AA Change: Y659C

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134268
Gene: ENSMUSG00000024462
AA Change: Y659C

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:Peripla_BP_6 52 428 7.8e-24 PFAM
Pfam:ANF_receptor 70 426 5.7e-68 PFAM
Pfam:7tm_3 484 743 1.1e-50 PFAM
coiled coil region 761 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173823
SMART Domains Protein: ENSMUSP00000133797
Gene: ENSMUSG00000024462

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sushi 29 95 1.6e-6 PFAM
low complexity region 159 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174071
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for gamma-aminobutyric acid (GABA), which is the main inhibitory neurotransmitter in the mammalian central nervous system. This receptor functions as a heterodimer with GABA(B) receptor 2. Defects in this gene may underlie brain disorders such as schizophrenia and epilepsy. Alternative splicing generates multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Phenotypes of null mice vary depending on strain background and allele. Homozygous null mice may display seizures, premature death, and abnormal nervous system electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
9930021J03Rik A G 19: 29,717,845 V1483A possibly damaging Het
Actb A G 5: 142,905,595 F31S probably damaging Het
Adamts7 T C 9: 90,188,697 S624P possibly damaging Het
Adh7 T C 3: 138,228,881 I355T possibly damaging Het
Arhgef40 A G 14: 52,004,081 E106G probably damaging Het
Cabp7 T C 11: 4,739,198 D149G probably damaging Het
Cass4 A T 2: 172,427,078 Q362L possibly damaging Het
Cd14 G A 18: 36,725,665 Q246* probably null Het
Cdr2l A C 11: 115,393,406 E189D probably benign Het
Col6a6 A G 9: 105,777,549 V991A probably damaging Het
Coq7 A G 7: 118,509,911 W305R unknown Het
Cracr2a G T 6: 127,603,929 G23* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Epcam T C 17: 87,639,938 L40P possibly damaging Het
Eps8 G A 6: 137,500,618 P531S probably benign Het
Faap100 C A 11: 120,377,088 L286F probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbn2 A T 18: 58,061,752 C1446S probably damaging Het
Fmo3 A G 1: 162,967,885 V127A probably damaging Het
Frem3 A G 8: 80,614,861 D1261G probably damaging Het
Gbp11 G T 5: 105,326,596 Q405K possibly damaging Het
Gdi2 T A 13: 3,560,051 V260E probably benign Het
Glp2r C T 11: 67,742,207 V98M possibly damaging Het
Gm13741 T C 2: 87,656,087 Y278C probably damaging Het
Gm7732 G A 17: 21,129,915 noncoding transcript Het
Gnptab T A 10: 88,428,482 probably null Het
Hbs1l T G 10: 21,358,835 F596V probably damaging Het
Krt78 A T 15: 101,951,844 probably null Het
Krt83 A T 15: 101,488,211 L223Q probably benign Het
Lcmt2 T C 2: 121,139,120 Y274C probably damaging Het
Limd1 A G 9: 123,518,154 Y620C probably damaging Het
Lvrn G T 18: 46,894,703 A862S probably damaging Het
Map4k2 A G 19: 6,343,341 E206G probably damaging Het
Med16 A G 10: 79,899,245 S461P probably damaging Het
Mrfap1 C A 5: 36,796,362 A78S probably damaging Het
Mum1 T A 10: 80,233,055 probably benign Het
Nav2 T A 7: 49,571,211 N1715K probably damaging Het
Ndc1 A G 4: 107,395,068 probably benign Het
Ngly1 G T 14: 16,290,867 G450* probably null Het
Olfr195 T C 16: 59,149,624 M258T probably benign Het
Olfr272 T A 4: 52,911,501 M98L probably benign Het
Pde3b T A 7: 114,519,556 Y643* probably null Het
Pdilt T G 7: 119,486,975 N506H possibly damaging Het
Pear1 C T 3: 87,751,853 probably null Het
Pfkp A T 13: 6,588,589 M582K probably damaging Het
Pigl T A 11: 62,512,994 F251I probably benign Het
Plk3 A G 4: 117,131,807 Y252H probably damaging Het
Prdx3 A G 19: 60,874,434 S12P possibly damaging Het
Prkag2 T C 5: 24,877,028 I96V probably benign Het
Rgs3 G A 4: 62,625,935 V146M probably damaging Het
Serpinh1 T C 7: 99,348,931 D164G probably damaging Het
Slc35d2 T C 13: 64,111,510 probably benign Het
Slc6a6 A G 6: 91,741,027 N316D probably damaging Het
Snx14 A T 9: 88,376,905 M973K possibly damaging Het
Sptan1 C G 2: 30,003,336 R1126G probably damaging Het
Stpg3 T C 2: 25,213,854 T157A probably benign Het
Tmem39b A T 4: 129,686,922 M259K possibly damaging Het
Tomm40l A T 1: 171,221,902 probably null Het
Tsen34 G T 7: 3,695,396 G180W probably damaging Het
Ube2l6 C T 2: 84,806,373 R54W probably damaging Het
Vdac1 A T 11: 52,384,070 T182S probably benign Het
Wdr3 T C 3: 100,151,199 probably benign Het
Wsb1 T A 11: 79,248,585 Q95L probably benign Het
Other mutations in Gabbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Gabbr1 APN 17 37048443 nonsense probably null
IGL01309:Gabbr1 APN 17 37048607 critical splice donor site probably null
IGL01413:Gabbr1 APN 17 37062706 missense possibly damaging 0.93
IGL01568:Gabbr1 APN 17 37070669 missense probably damaging 1.00
IGL01845:Gabbr1 APN 17 37048414 splice site probably benign
IGL02083:Gabbr1 APN 17 37070065 missense possibly damaging 0.84
IGL02302:Gabbr1 APN 17 37054797 missense probably damaging 1.00
IGL02430:Gabbr1 APN 17 37056308 nonsense probably null
IGL02533:Gabbr1 APN 17 37072147 missense probably damaging 1.00
IGL02810:Gabbr1 APN 17 37062762 missense probably damaging 1.00
H8562:Gabbr1 UTSW 17 37071949 missense probably damaging 1.00
PIT4449001:Gabbr1 UTSW 17 37056350 missense probably damaging 1.00
R0025:Gabbr1 UTSW 17 37067210 intron probably benign
R0420:Gabbr1 UTSW 17 37046762 missense possibly damaging 0.68
R0464:Gabbr1 UTSW 17 37050834 unclassified probably benign
R1306:Gabbr1 UTSW 17 37055990 intron probably null
R1412:Gabbr1 UTSW 17 37054913 splice site probably null
R1495:Gabbr1 UTSW 17 37055940 missense possibly damaging 0.68
R1658:Gabbr1 UTSW 17 37047507 missense probably damaging 0.96
R1763:Gabbr1 UTSW 17 37054767 missense probably damaging 1.00
R1779:Gabbr1 UTSW 17 37054879 missense probably damaging 1.00
R1964:Gabbr1 UTSW 17 37048459 missense probably damaging 1.00
R1996:Gabbr1 UTSW 17 37069220 missense probably damaging 1.00
R2014:Gabbr1 UTSW 17 37056782 splice site probably null
R2255:Gabbr1 UTSW 17 37071866 missense probably damaging 1.00
R4299:Gabbr1 UTSW 17 37055900 nonsense probably null
R4458:Gabbr1 UTSW 17 37067775 critical splice acceptor site probably null
R4510:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4511:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4571:Gabbr1 UTSW 17 37054236 nonsense probably null
R4597:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.74
R5109:Gabbr1 UTSW 17 37072028 intron probably benign
R5119:Gabbr1 UTSW 17 37048438 missense probably damaging 0.99
R5227:Gabbr1 UTSW 17 37070066 missense possibly damaging 0.93
R5253:Gabbr1 UTSW 17 37055913 missense possibly damaging 0.87
R5443:Gabbr1 UTSW 17 37070756 missense probably damaging 1.00
R5485:Gabbr1 UTSW 17 37056875 missense possibly damaging 0.83
R5839:Gabbr1 UTSW 17 37067868 missense probably damaging 1.00
R5976:Gabbr1 UTSW 17 37067862 missense probably damaging 1.00
R6156:Gabbr1 UTSW 17 37048427 missense probably benign 0.01
R6167:Gabbr1 UTSW 17 37063379 missense probably damaging 1.00
R6214:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6215:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6348:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.94
R6721:Gabbr1 UTSW 17 37054192 missense probably damaging 0.98
R7028:Gabbr1 UTSW 17 37064737 nonsense probably null
X0010:Gabbr1 UTSW 17 37070780 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCAGCTCCTGAAAGTAAGTGAC -3'
(R):5'- ATGGCCCATTTCCAGGACCAAC -3'

Sequencing Primer
(F):5'- TTCTAGCCGCTCCATAGGAAG -3'
(R):5'- CCAACGCCAGGTGTCAAG -3'
Posted On2014-04-24