Incidental Mutation 'R1612:Lvrn'
ID176900
Institutional Source Beutler Lab
Gene Symbol Lvrn
Ensembl Gene ENSMUSG00000024481
Gene Namelaeverin
Synonyms4833403I15Rik, Aqpep
MMRRC Submission 039649-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R1612 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location46850039-46905446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46894703 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 862 (A862S)
Ref Sequence ENSEMBL: ENSMUSP00000025358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025358]
Predicted Effect probably damaging
Transcript: ENSMUST00000025358
AA Change: A862S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025358
Gene: ENSMUSG00000024481
AA Change: A862S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Peptidase_M1 94 504 1.6e-110 PFAM
Pfam:ERAP1_C 645 968 2.5e-60 PFAM
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 97% (69/71)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
9930021J03Rik A G 19: 29,717,845 V1483A possibly damaging Het
Actb A G 5: 142,905,595 F31S probably damaging Het
Adamts7 T C 9: 90,188,697 S624P possibly damaging Het
Adh7 T C 3: 138,228,881 I355T possibly damaging Het
Arhgef40 A G 14: 52,004,081 E106G probably damaging Het
Cabp7 T C 11: 4,739,198 D149G probably damaging Het
Cass4 A T 2: 172,427,078 Q362L possibly damaging Het
Cd14 G A 18: 36,725,665 Q246* probably null Het
Cdr2l A C 11: 115,393,406 E189D probably benign Het
Col6a6 A G 9: 105,777,549 V991A probably damaging Het
Coq7 A G 7: 118,509,911 W305R unknown Het
Cracr2a G T 6: 127,603,929 G23* probably null Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Epcam T C 17: 87,639,938 L40P possibly damaging Het
Eps8 G A 6: 137,500,618 P531S probably benign Het
Faap100 C A 11: 120,377,088 L286F probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbn2 A T 18: 58,061,752 C1446S probably damaging Het
Fmo3 A G 1: 162,967,885 V127A probably damaging Het
Frem3 A G 8: 80,614,861 D1261G probably damaging Het
Gabbr1 A G 17: 37,070,669 Y775C probably damaging Het
Gbp11 G T 5: 105,326,596 Q405K possibly damaging Het
Gdi2 T A 13: 3,560,051 V260E probably benign Het
Glp2r C T 11: 67,742,207 V98M possibly damaging Het
Gm13741 T C 2: 87,656,087 Y278C probably damaging Het
Gm7732 G A 17: 21,129,915 noncoding transcript Het
Gnptab T A 10: 88,428,482 probably null Het
Hbs1l T G 10: 21,358,835 F596V probably damaging Het
Krt78 A T 15: 101,951,844 probably null Het
Krt83 A T 15: 101,488,211 L223Q probably benign Het
Lcmt2 T C 2: 121,139,120 Y274C probably damaging Het
Limd1 A G 9: 123,518,154 Y620C probably damaging Het
Map4k2 A G 19: 6,343,341 E206G probably damaging Het
Med16 A G 10: 79,899,245 S461P probably damaging Het
Mrfap1 C A 5: 36,796,362 A78S probably damaging Het
Mum1 T A 10: 80,233,055 probably benign Het
Nav2 T A 7: 49,571,211 N1715K probably damaging Het
Ndc1 A G 4: 107,395,068 probably benign Het
Ngly1 G T 14: 16,290,867 G450* probably null Het
Olfr195 T C 16: 59,149,624 M258T probably benign Het
Olfr272 T A 4: 52,911,501 M98L probably benign Het
Pde3b T A 7: 114,519,556 Y643* probably null Het
Pdilt T G 7: 119,486,975 N506H possibly damaging Het
Pear1 C T 3: 87,751,853 probably null Het
Pfkp A T 13: 6,588,589 M582K probably damaging Het
Pigl T A 11: 62,512,994 F251I probably benign Het
Plk3 A G 4: 117,131,807 Y252H probably damaging Het
Prdx3 A G 19: 60,874,434 S12P possibly damaging Het
Prkag2 T C 5: 24,877,028 I96V probably benign Het
Rgs3 G A 4: 62,625,935 V146M probably damaging Het
Serpinh1 T C 7: 99,348,931 D164G probably damaging Het
Slc35d2 T C 13: 64,111,510 probably benign Het
Slc6a6 A G 6: 91,741,027 N316D probably damaging Het
Snx14 A T 9: 88,376,905 M973K possibly damaging Het
Sptan1 C G 2: 30,003,336 R1126G probably damaging Het
Stpg3 T C 2: 25,213,854 T157A probably benign Het
Tmem39b A T 4: 129,686,922 M259K possibly damaging Het
Tomm40l A T 1: 171,221,902 probably null Het
Tsen34 G T 7: 3,695,396 G180W probably damaging Het
Ube2l6 C T 2: 84,806,373 R54W probably damaging Het
Vdac1 A T 11: 52,384,070 T182S probably benign Het
Wdr3 T C 3: 100,151,199 probably benign Het
Wsb1 T A 11: 79,248,585 Q95L probably benign Het
Other mutations in Lvrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Lvrn APN 18 46864666 splice site probably benign
IGL01532:Lvrn APN 18 46900484 missense probably damaging 1.00
IGL02430:Lvrn APN 18 46894730 missense probably benign 0.03
IGL02573:Lvrn APN 18 46876949 missense probably damaging 0.98
IGL02592:Lvrn APN 18 46850591 missense probably damaging 1.00
IGL02754:Lvrn APN 18 46890904 nonsense probably null
IGL03089:Lvrn APN 18 46880709 missense probably damaging 0.99
IGL03209:Lvrn APN 18 46889498 missense probably benign 0.00
IGL03333:Lvrn APN 18 46864664 splice site probably benign
IGL03098:Lvrn UTSW 18 46881410 critical splice acceptor site probably null
R0319:Lvrn UTSW 18 46864753 missense probably damaging 1.00
R0391:Lvrn UTSW 18 46850466 missense probably benign 0.01
R0398:Lvrn UTSW 18 46880693 missense probably benign 0.06
R0432:Lvrn UTSW 18 46905299 missense possibly damaging 0.94
R0456:Lvrn UTSW 18 46864816 critical splice donor site probably null
R1458:Lvrn UTSW 18 46882385 splice site probably benign
R1935:Lvrn UTSW 18 46878320 missense probably benign 0.10
R1936:Lvrn UTSW 18 46878320 missense probably benign 0.10
R1959:Lvrn UTSW 18 46894717 missense probably damaging 1.00
R2000:Lvrn UTSW 18 46905307 missense probably benign 0.04
R2022:Lvrn UTSW 18 46866436 missense possibly damaging 0.81
R2106:Lvrn UTSW 18 46878289 missense probably damaging 1.00
R2197:Lvrn UTSW 18 46878342 missense probably benign 0.03
R2371:Lvrn UTSW 18 46878163 intron probably null
R4125:Lvrn UTSW 18 46876969 missense possibly damaging 0.53
R4606:Lvrn UTSW 18 46864765 missense possibly damaging 0.92
R4830:Lvrn UTSW 18 46905351 missense probably damaging 1.00
R4866:Lvrn UTSW 18 46893701 missense probably damaging 1.00
R4900:Lvrn UTSW 18 46893701 missense probably damaging 1.00
R4900:Lvrn UTSW 18 46881412 missense probably damaging 1.00
R4924:Lvrn UTSW 18 46894725 missense probably damaging 1.00
R4948:Lvrn UTSW 18 46880736 missense probably damaging 1.00
R5167:Lvrn UTSW 18 46880747 missense probably damaging 0.99
R5527:Lvrn UTSW 18 46873803 missense probably damaging 1.00
R5581:Lvrn UTSW 18 46890865 missense probably benign 0.17
R5615:Lvrn UTSW 18 46850328 missense possibly damaging 0.55
R5859:Lvrn UTSW 18 46893749 missense probably damaging 1.00
R6149:Lvrn UTSW 18 46884432 missense probably benign 0.10
R6183:Lvrn UTSW 18 46850685 missense probably benign 0.14
R6378:Lvrn UTSW 18 46894957 missense probably benign 0.00
R6838:Lvrn UTSW 18 46890880 missense possibly damaging 0.88
R6993:Lvrn UTSW 18 46882298 missense probably benign 0.18
R7017:Lvrn UTSW 18 46850678 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTCTGAGCTACCACAGGGGAATG -3'
(R):5'- GCAATGTACCGGCCAACTTCAGATG -3'

Sequencing Primer
(F):5'- TACCACAGGGGAATGCCTTC -3'
(R):5'- TGCAGTGATGGCATACTCC -3'
Posted On2014-04-24