Incidental Mutation 'R1613:Tlr2'
ID176916
Institutional Source Beutler Lab
Gene Symbol Tlr2
Ensembl Gene ENSMUSG00000027995
Gene Nametoll-like receptor 2
SynonymsLy105
MMRRC Submission 039650-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1613 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location83836272-83841767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 83837353 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 474 (L474F)
Ref Sequence ENSEMBL: ENSMUSP00000029623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029623]
Predicted Effect probably damaging
Transcript: ENSMUST00000029623
AA Change: L474F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029623
Gene: ENSMUSG00000027995
AA Change: L474F

DomainStartEndE-ValueType
LRR 51 74 1.45e2 SMART
LRR 75 98 2.33e2 SMART
LRR_TYP 99 122 3.69e-4 SMART
low complexity region 268 281 N/A INTRINSIC
LRR 359 384 6.78e1 SMART
LRR 386 409 2.54e2 SMART
LRR 412 435 8.49e1 SMART
LRR_TYP 476 499 3.34e-2 SMART
LRRCT 533 586 5.04e-7 SMART
transmembrane domain 588 610 N/A INTRINSIC
TIR 640 784 5.08e-38 SMART
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 82% (69/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. This protein is a cell-surface protein that can form heterodimers with other TLR family members to recognize conserved molecules derived from microorganisms known as pathogen-associated molecular patterns (PAMPs). Activation of TLRs by PAMPs leads to an up-regulation of signaling pathways to modulate the host's inflammatory response. This gene is also thought to promote apoptosis in response to bacterial lipoproteins. This gene has been implicated in the pathogenesis of several autoimmune diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice demonstrate abnormal responses to bacterial and viral infections. Mice homozygous for a knock-out allele also exhibit disruption in circadian active and inactive state consolidation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aldh3a1 A T 11: 61,214,551 D161V probably damaging Het
Aloxe3 A G 11: 69,130,046 D199G possibly damaging Het
Amfr T A 8: 93,999,226 M176L probably benign Het
Amigo1 A T 3: 108,188,220 E345V probably benign Het
Atp13a3 T C 16: 30,332,300 Y1064C probably damaging Het
AU019823 T C 9: 50,607,805 K169R probably damaging Het
Brd7 A T 8: 88,346,950 C271S probably benign Het
Bub1b T A 2: 118,639,741 probably null Het
Ccdc146 T A 5: 21,294,524 I887F probably damaging Het
Ceacam14 T C 7: 17,814,048 probably benign Het
Cntn1 T A 15: 92,245,990 V278E possibly damaging Het
Col6a6 A C 9: 105,732,211 probably null Het
Cspp1 C T 1: 10,133,241 R1016C probably damaging Het
Cyp2c39 A G 19: 39,539,011 Y267C probably damaging Het
Cyp2c67 C T 19: 39,626,199 V295I probably benign Het
Cyp2d40 T C 15: 82,761,439 T122A unknown Het
Dmxl2 A G 9: 54,382,027 I2541T probably benign Het
Eif3e G A 15: 43,250,224 A438V possibly damaging Het
Fam178b C A 1: 36,600,192 W342L probably benign Het
Fam45a T A 19: 60,822,325 V171D possibly damaging Het
Fam78a G T 2: 32,069,569 N176K probably damaging Het
Ghrhr A T 6: 55,379,697 K93M probably damaging Het
Gm1527 T A 3: 28,898,853 probably null Het
Gm1553 G A 10: 82,492,596 probably benign Het
Gm5885 G A 6: 133,531,242 noncoding transcript Het
Gm8674 G A 13: 49,902,438 noncoding transcript Het
Hoxc6 C T 15: 103,009,585 probably benign Het
Ino80 T C 2: 119,392,867 T1189A probably damaging Het
Iqgap1 T C 7: 80,768,457 E55G probably damaging Het
Kcnh2 G A 5: 24,322,762 probably benign Het
Lama1 G A 17: 67,807,923 G2356S probably benign Het
Mdfic T A 6: 15,799,590 probably null Het
Me3 T C 7: 89,786,420 probably benign Het
Mmadhc T C 2: 50,280,326 D258G probably damaging Het
Nfe2 T C 15: 103,249,129 D145G probably damaging Het
Olfr1039 A T 2: 86,131,063 L200Q probably damaging Het
Olfr1200 T C 2: 88,767,805 N170S probably damaging Het
Olfr1377 T A 11: 50,985,218 N172K probably damaging Het
Olfr1391 A G 11: 49,327,693 Y94C probably damaging Het
Olfr1404 C T 1: 173,215,867 T72I probably benign Het
Olfr352 A C 2: 36,870,393 I276L possibly damaging Het
Olfr728 A C 14: 50,140,294 L115R probably damaging Het
P4ha3 A T 7: 100,313,250 D405V possibly damaging Het
Palmd T C 3: 116,923,504 D448G probably damaging Het
Pclo T C 5: 14,679,132 probably benign Het
Pcsk6 A G 7: 65,910,311 probably benign Het
Pidd1 T C 7: 141,440,777 E469G probably damaging Het
Ptpn13 A G 5: 103,536,871 D875G possibly damaging Het
Rasgrf2 A G 13: 91,902,621 L886P probably damaging Het
Scrib G A 15: 76,048,542 R1454C probably damaging Het
Slc24a1 A G 9: 64,948,696 S310P unknown Het
Slc44a5 A G 3: 154,257,714 probably null Het
Snx4 T G 16: 33,286,046 M283R probably damaging Het
Snx7 A T 3: 117,829,573 probably benign Het
Stk19 A T 17: 34,824,598 L212H probably damaging Het
Sult2a4 T C 7: 13,989,495 K32E probably damaging Het
Tfrc T A 16: 32,623,375 Y473N probably damaging Het
Tnfrsf4 T A 4: 156,016,162 F213I probably benign Het
Trim9 A T 12: 70,248,395 I651N probably damaging Het
Vmn1r84 T A 7: 12,362,533 I78L possibly damaging Het
Vmn2r77 T C 7: 86,811,148 Y561H probably damaging Het
Vmn2r95 A G 17: 18,440,639 probably benign Het
Zfp11 T C 5: 129,658,367 N10S probably benign Het
Zfp81 A T 17: 33,334,783 H352Q probably damaging Het
Zscan5b T A 7: 6,230,375 L66Q probably damaging Het
Other mutations in Tlr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01762:Tlr2 APN 3 83836994 missense probably benign
IGL02160:Tlr2 APN 3 83837371 missense possibly damaging 0.47
IGL02405:Tlr2 APN 3 83836674 missense probably damaging 1.00
IGL02940:Tlr2 APN 3 83836474 missense probably benign 0.03
IGL03165:Tlr2 APN 3 83837948 missense probably benign 0.00
languid UTSW 3 83837315 missense probably damaging 1.00
PIT4131001:Tlr2 UTSW 3 83838449 missense probably benign 0.34
R1177:Tlr2 UTSW 3 83838734 missense probably benign 0.02
R1251:Tlr2 UTSW 3 83838269 missense possibly damaging 0.64
R1346:Tlr2 UTSW 3 83836593 missense probably damaging 0.99
R1553:Tlr2 UTSW 3 83837463 missense probably benign
R1816:Tlr2 UTSW 3 83838209 missense probably damaging 1.00
R2312:Tlr2 UTSW 3 83837540 missense probably damaging 1.00
R3023:Tlr2 UTSW 3 83837871 missense probably benign
R4724:Tlr2 UTSW 3 83838185 missense probably damaging 1.00
R4950:Tlr2 UTSW 3 83837332 missense probably damaging 1.00
R5109:Tlr2 UTSW 3 83837723 missense probably damaging 1.00
R5764:Tlr2 UTSW 3 83838512 missense probably damaging 1.00
R5859:Tlr2 UTSW 3 83836503 missense possibly damaging 0.94
R6169:Tlr2 UTSW 3 83838148 missense probably benign
R6236:Tlr2 UTSW 3 83838131 missense probably benign
R6384:Tlr2 UTSW 3 83836994 missense probably benign
R6564:Tlr2 UTSW 3 83837695 missense probably benign 0.05
R6725:Tlr2 UTSW 3 83838296 missense probably benign
R7032:Tlr2 UTSW 3 83837905 missense probably benign 0.01
R7256:Tlr2 UTSW 3 83837606 missense not run
Predicted Primers PCR Primer
(F):5'- CAGTCAACCAGGATTTGAGCCAGAG -3'
(R):5'- TTTTCATCCGATGCCCGACAGC -3'

Sequencing Primer
(F):5'- GCTGGCGTCTCCATAGTAAAG -3'
(R):5'- TGCGCTTCCTGAATTTGTCC -3'
Posted On2014-04-24