Incidental Mutation 'R1613:P4ha3'
ID176937
Institutional Source Beutler Lab
Gene Symbol P4ha3
Ensembl Gene ENSMUSG00000051048
Gene Nameprocollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III
Synonyms
MMRRC Submission 039650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.042) question?
Stock #R1613 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100285520-100319699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100313250 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 405 (D405V)
Ref Sequence ENSEMBL: ENSMUSP00000055297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057023] [ENSMUST00000139790]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057023
AA Change: D405V

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055297
Gene: ENSMUSG00000051048
AA Change: D405V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:P4Ha_N 31 159 1.4e-31 PFAM
SCOP:d1ihga1 177 258 8e-4 SMART
P4Hc 344 526 1.08e-50 SMART
Predicted Effect unknown
Transcript: ENSMUST00000138465
AA Change: D271V
SMART Domains Protein: ENSMUSP00000119159
Gene: ENSMUSG00000051048
AA Change: D271V

DomainStartEndE-ValueType
PDB:4BTB|A 1 141 7e-17 PDB
SCOP:d1ihga1 44 125 4e-4 SMART
P4Hc 211 372 4.89e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139790
SMART Domains Protein: ENSMUSP00000117015
Gene: ENSMUSG00000051048

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208565
Meta Mutation Damage Score 0.0996 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.5%
Validation Efficiency 82% (69/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aldh3a1 A T 11: 61,214,551 D161V probably damaging Het
Aloxe3 A G 11: 69,130,046 D199G possibly damaging Het
Amfr T A 8: 93,999,226 M176L probably benign Het
Amigo1 A T 3: 108,188,220 E345V probably benign Het
Atp13a3 T C 16: 30,332,300 Y1064C probably damaging Het
AU019823 T C 9: 50,607,805 K169R probably damaging Het
Brd7 A T 8: 88,346,950 C271S probably benign Het
Bub1b T A 2: 118,639,741 probably null Het
Ccdc146 T A 5: 21,294,524 I887F probably damaging Het
Ceacam14 T C 7: 17,814,048 probably benign Het
Cntn1 T A 15: 92,245,990 V278E possibly damaging Het
Col6a6 A C 9: 105,732,211 probably null Het
Cspp1 C T 1: 10,133,241 R1016C probably damaging Het
Cyp2c39 A G 19: 39,539,011 Y267C probably damaging Het
Cyp2c67 C T 19: 39,626,199 V295I probably benign Het
Cyp2d40 T C 15: 82,761,439 T122A unknown Het
Dmxl2 A G 9: 54,382,027 I2541T probably benign Het
Eif3e G A 15: 43,250,224 A438V possibly damaging Het
Fam178b C A 1: 36,600,192 W342L probably benign Het
Fam45a T A 19: 60,822,325 V171D possibly damaging Het
Fam78a G T 2: 32,069,569 N176K probably damaging Het
Ghrhr A T 6: 55,379,697 K93M probably damaging Het
Gm1527 T A 3: 28,898,853 probably null Het
Gm1553 G A 10: 82,492,596 probably benign Het
Gm5885 G A 6: 133,531,242 noncoding transcript Het
Gm8674 G A 13: 49,902,438 noncoding transcript Het
Hoxc6 C T 15: 103,009,585 probably benign Het
Ino80 T C 2: 119,392,867 T1189A probably damaging Het
Iqgap1 T C 7: 80,768,457 E55G probably damaging Het
Kcnh2 G A 5: 24,322,762 probably benign Het
Lama1 G A 17: 67,807,923 G2356S probably benign Het
Mdfic T A 6: 15,799,590 probably null Het
Me3 T C 7: 89,786,420 probably benign Het
Mmadhc T C 2: 50,280,326 D258G probably damaging Het
Nfe2 T C 15: 103,249,129 D145G probably damaging Het
Olfr1039 A T 2: 86,131,063 L200Q probably damaging Het
Olfr1200 T C 2: 88,767,805 N170S probably damaging Het
Olfr1377 T A 11: 50,985,218 N172K probably damaging Het
Olfr1391 A G 11: 49,327,693 Y94C probably damaging Het
Olfr1404 C T 1: 173,215,867 T72I probably benign Het
Olfr352 A C 2: 36,870,393 I276L possibly damaging Het
Olfr728 A C 14: 50,140,294 L115R probably damaging Het
Palmd T C 3: 116,923,504 D448G probably damaging Het
Pclo T C 5: 14,679,132 probably benign Het
Pcsk6 A G 7: 65,910,311 probably benign Het
Pidd1 T C 7: 141,440,777 E469G probably damaging Het
Ptpn13 A G 5: 103,536,871 D875G possibly damaging Het
Rasgrf2 A G 13: 91,902,621 L886P probably damaging Het
Scrib G A 15: 76,048,542 R1454C probably damaging Het
Slc24a1 A G 9: 64,948,696 S310P unknown Het
Slc44a5 A G 3: 154,257,714 probably null Het
Snx4 T G 16: 33,286,046 M283R probably damaging Het
Snx7 A T 3: 117,829,573 probably benign Het
Stk19 A T 17: 34,824,598 L212H probably damaging Het
Sult2a4 T C 7: 13,989,495 K32E probably damaging Het
Tfrc T A 16: 32,623,375 Y473N probably damaging Het
Tlr2 C G 3: 83,837,353 L474F probably damaging Het
Tnfrsf4 T A 4: 156,016,162 F213I probably benign Het
Trim9 A T 12: 70,248,395 I651N probably damaging Het
Vmn1r84 T A 7: 12,362,533 I78L possibly damaging Het
Vmn2r77 T C 7: 86,811,148 Y561H probably damaging Het
Vmn2r95 A G 17: 18,440,639 probably benign Het
Zfp11 T C 5: 129,658,367 N10S probably benign Het
Zfp81 A T 17: 33,334,783 H352Q probably damaging Het
Zscan5b T A 7: 6,230,375 L66Q probably damaging Het
Other mutations in P4ha3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:P4ha3 APN 7 100305933 missense probably damaging 1.00
IGL01875:P4ha3 APN 7 100300652 missense probably damaging 0.97
IGL02265:P4ha3 APN 7 100293932 missense probably benign
IGL02957:P4ha3 APN 7 100318905 splice site probably benign
IGL03279:P4ha3 APN 7 100300686 missense probably damaging 1.00
R0006:P4ha3 UTSW 7 100318948 nonsense probably null
R0880:P4ha3 UTSW 7 100305909 missense probably benign 0.06
R1066:P4ha3 UTSW 7 100318063 missense possibly damaging 0.77
R1118:P4ha3 UTSW 7 100313328 missense probably damaging 0.99
R1119:P4ha3 UTSW 7 100313328 missense probably damaging 0.99
R1236:P4ha3 UTSW 7 100293849 missense probably damaging 1.00
R1778:P4ha3 UTSW 7 100300691 splice site probably null
R2042:P4ha3 UTSW 7 100300690 critical splice donor site probably null
R3437:P4ha3 UTSW 7 100285624 missense possibly damaging 0.93
R4393:P4ha3 UTSW 7 100305607 missense probably benign 0.06
R5411:P4ha3 UTSW 7 100293815 missense probably damaging 1.00
R5722:P4ha3 UTSW 7 100305991 missense probably benign 0.03
R6209:P4ha3 UTSW 7 100317085 missense probably benign 0.09
R6462:P4ha3 UTSW 7 100314666 missense probably damaging 1.00
R6606:P4ha3 UTSW 7 100305644 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGACCTGACATGAAGGATGAGTG -3'
(R):5'- AAGGAAAATACATGGGCTCCCTGC -3'

Sequencing Primer
(F):5'- TCCCTCTGGTAACAACCAtcattc -3'
(R):5'- TCCCTGCCCCAGAAGACTG -3'
Posted On2014-04-24