Incidental Mutation 'R1614:Zbtb18'
ID176976
Institutional Source Beutler Lab
Gene Symbol Zbtb18
Ensembl Gene ENSMUSG00000063659
Gene Namezinc finger and BTB domain containing 18
SynonymsRP58, Zfp238
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1614 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location177442351-177450764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 177447170 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 23 (L23P)
Ref Sequence ENSEMBL: ENSMUSP00000141724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077225] [ENSMUST00000094276] [ENSMUST00000192699] [ENSMUST00000192851] [ENSMUST00000193440] [ENSMUST00000193480] [ENSMUST00000194319] [ENSMUST00000195002] [ENSMUST00000195388] [ENSMUST00000195549] [ENSMUST00000195612]
Predicted Effect probably damaging
Transcript: ENSMUST00000077225
AA Change: L23P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076463
Gene: ENSMUSG00000063659
AA Change: L23P

DomainStartEndE-ValueType
BTB 24 121 2.55e-22 SMART
ZnF_C2H2 370 392 1.28e-3 SMART
ZnF_C2H2 410 432 1.01e-1 SMART
ZnF_C2H2 438 460 9.58e-3 SMART
ZnF_C2H2 466 489 1.18e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094276
AA Change: L32P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091831
Gene: ENSMUSG00000063659
AA Change: L32P

DomainStartEndE-ValueType
BTB 33 130 2.55e-22 SMART
ZnF_C2H2 379 401 1.28e-3 SMART
ZnF_C2H2 419 441 1.01e-1 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 498 1.18e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180591
Predicted Effect probably benign
Transcript: ENSMUST00000192699
Predicted Effect probably damaging
Transcript: ENSMUST00000192851
AA Change: L23P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142256
Gene: ENSMUSG00000063659
AA Change: L23P

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193440
AA Change: L23P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141337
Gene: ENSMUSG00000063659
AA Change: L23P

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193480
AA Change: L32P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141663
Gene: ENSMUSG00000063659
AA Change: L32P

DomainStartEndE-ValueType
BTB 33 130 1.6e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194269
Predicted Effect probably benign
Transcript: ENSMUST00000194319
Predicted Effect probably damaging
Transcript: ENSMUST00000195002
AA Change: L23P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000195388
AA Change: L23P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141694
Gene: ENSMUSG00000063659
AA Change: L23P

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195549
AA Change: L23P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142073
Gene: ENSMUSG00000063659
AA Change: L23P

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195612
AA Change: L23P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141724
Gene: ENSMUSG00000063659
AA Change: L23P

DomainStartEndE-ValueType
BTB 24 121 2.55e-22 SMART
ZnF_C2H2 370 392 1.28e-3 SMART
ZnF_C2H2 410 432 1.01e-1 SMART
ZnF_C2H2 438 460 9.58e-3 SMART
ZnF_C2H2 466 489 1.18e-2 SMART
Meta Mutation Damage Score 0.452 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein which acts a transcriptional repressor of genes involved in neuronal development. The encoded protein recognizes a specific sequence motif and recruits components of chromatin to target genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, cortical and hippocampal hypoplasia and laminar disorganization, and abnormal neuron apoptosis and cell cycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Atpaf1 A T 4: 115,796,757 K201N possibly damaging Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gm6741 T A 17: 91,236,996 H62Q probably benign Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Itgb1 G A 8: 128,720,065 C401Y probably damaging Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Nabp1 T C 1: 51,471,352 N164D possibly damaging Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Olfr346 T G 2: 36,688,309 Y102* probably null Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Pecam1 T C 11: 106,681,079 D554G probably benign Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Pop1 C A 15: 34,530,210 A918D possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ptgfr A C 3: 151,801,779 Y316D probably benign Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Slc17a6 G A 7: 51,646,277 probably benign Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r27 T G 6: 124,223,934 I355L probably benign Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Zbtb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Zbtb18 APN 1 177447983 missense probably benign 0.01
IGL01967:Zbtb18 APN 1 177447782 missense probably benign 0.25
PIT4434001:Zbtb18 UTSW 1 177448423 missense possibly damaging 0.93
R0085:Zbtb18 UTSW 1 177447935 missense probably benign 0.00
R0119:Zbtb18 UTSW 1 177448157 missense probably benign 0.05
R0309:Zbtb18 UTSW 1 177448616 missense probably damaging 0.99
R1660:Zbtb18 UTSW 1 177447763 missense probably benign 0.05
R1676:Zbtb18 UTSW 1 177447347 unclassified probably null
R1750:Zbtb18 UTSW 1 177447511 missense possibly damaging 0.95
R2365:Zbtb18 UTSW 1 177448157 missense probably benign 0.05
R4282:Zbtb18 UTSW 1 177447479 missense probably damaging 1.00
R4497:Zbtb18 UTSW 1 177447121 missense probably damaging 1.00
R4542:Zbtb18 UTSW 1 177448666 missense probably damaging 0.99
R4678:Zbtb18 UTSW 1 177447719 missense probably benign 0.04
R5450:Zbtb18 UTSW 1 177447205 missense probably damaging 1.00
R5726:Zbtb18 UTSW 1 177448553 missense probably damaging 1.00
R5828:Zbtb18 UTSW 1 177447880 missense probably damaging 0.98
R5879:Zbtb18 UTSW 1 177448370 missense probably damaging 1.00
R6379:Zbtb18 UTSW 1 177447575 missense probably damaging 0.99
R6641:Zbtb18 UTSW 1 177448043 missense probably damaging 0.98
R7088:Zbtb18 UTSW 1 177447254 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAACTCTCCACCACTAAGGCGG -3'
(R):5'- CATCTTCATCACTGGGCAGGTCAC -3'

Sequencing Primer
(F):5'- CGGATATTTTTTAAAGTGGCGAC -3'
(R):5'- CCTCAATGGGCAAGTCTTTGAAC -3'
Posted On2014-04-24