Incidental Mutation 'R1614:Olfr346'
ID176978
Institutional Source Beutler Lab
Gene Symbol Olfr346
Ensembl Gene ENSMUSG00000094764
Gene Nameolfactory receptor 346
SynonymsMOR136-11, GA_x6K02T2NLDC-33382467-33383396
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1614 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36685788-36691293 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 36688309 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 102 (Y102*)
Ref Sequence ENSEMBL: ENSMUSP00000149916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078854] [ENSMUST00000213258]
Predicted Effect probably null
Transcript: ENSMUST00000078854
AA Change: Y102*
SMART Domains Protein: ENSMUSP00000077897
Gene: ENSMUSG00000094764
AA Change: Y102*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.2e-58 PFAM
Pfam:7tm_1 41 290 1.3e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213258
AA Change: Y102*
Meta Mutation Damage Score 0.61 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Atpaf1 A T 4: 115,796,757 K201N possibly damaging Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gm6741 T A 17: 91,236,996 H62Q probably benign Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Itgb1 G A 8: 128,720,065 C401Y probably damaging Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Nabp1 T C 1: 51,471,352 N164D possibly damaging Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Pecam1 T C 11: 106,681,079 D554G probably benign Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Pop1 C A 15: 34,530,210 A918D possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ptgfr A C 3: 151,801,779 Y316D probably benign Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Slc17a6 G A 7: 51,646,277 probably benign Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r27 T G 6: 124,223,934 I355L probably benign Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zbtb18 T C 1: 177,447,170 L23P probably damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Olfr346
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Olfr346 APN 2 36688538 missense probably damaging 1.00
IGL01770:Olfr346 APN 2 36688105 missense probably benign 0.02
IGL02110:Olfr346 APN 2 36688685 missense probably benign
IGL02212:Olfr346 APN 2 36688182 missense probably damaging 0.98
IGL02346:Olfr346 APN 2 36688004 start codon destroyed probably benign 0.41
IGL02544:Olfr346 APN 2 36688836 missense probably damaging 1.00
IGL02995:Olfr346 APN 2 36688632 missense possibly damaging 0.56
IGL03154:Olfr346 APN 2 36688643 missense possibly damaging 0.78
IGL03389:Olfr346 APN 2 36688262 missense probably benign 0.12
R0100:Olfr346 UTSW 2 36688911 missense probably benign 0.00
R0230:Olfr346 UTSW 2 36688616 missense probably benign 0.01
R1559:Olfr346 UTSW 2 36688758 missense probably damaging 1.00
R1560:Olfr346 UTSW 2 36688143 missense probably damaging 1.00
R1697:Olfr346 UTSW 2 36688247 missense probably damaging 1.00
R1738:Olfr346 UTSW 2 36688785 missense probably benign 0.44
R1966:Olfr346 UTSW 2 36688784 missense probably benign 0.01
R2021:Olfr346 UTSW 2 36688475 missense probably benign
R2181:Olfr346 UTSW 2 36688334 missense probably damaging 1.00
R4170:Olfr346 UTSW 2 36688722 missense probably damaging 0.98
R4625:Olfr346 UTSW 2 36688071 missense probably benign 0.06
R5081:Olfr346 UTSW 2 36688643 missense possibly damaging 0.73
R5335:Olfr346 UTSW 2 36688094 missense probably benign
R5966:Olfr346 UTSW 2 36688062 missense probably null 0.00
R5978:Olfr346 UTSW 2 36688682 missense probably benign 0.07
R6110:Olfr346 UTSW 2 36688547 missense probably benign 0.01
R6329:Olfr346 UTSW 2 36688682 nonsense probably null
R7214:Olfr346 UTSW 2 36688095 missense probably benign 0.35
R7301:Olfr346 UTSW 2 36688011 missense probably benign
R7382:Olfr346 UTSW 2 36688034 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCTGACAACTGTGCTGGGGAAC -3'
(R):5'- TCAGAATGGTGACACCAATGTAGCC -3'

Sequencing Primer
(F):5'- TGGGGAACCTGCTCATCATC -3'
(R):5'- TGGTGACACCAATGTAGCCATAAG -3'
Posted On2014-04-24