Incidental Mutation 'R1614:Ptgfr'
ID176985
Institutional Source Beutler Lab
Gene Symbol Ptgfr
Ensembl Gene ENSMUSG00000028036
Gene Nameprostaglandin F receptor
SynonymsFP, PGF
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1614 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location151796502-151837630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 151801779 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 316 (Y316D)
Ref Sequence ENSEMBL: ENSMUSP00000101732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029670] [ENSMUST00000106126]
Predicted Effect probably benign
Transcript: ENSMUST00000029670
AA Change: Y316D

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029670
Gene: ENSMUSG00000028036
AA Change: Y316D

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 6.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106126
AA Change: Y316D

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101732
Gene: ENSMUSG00000028036
AA Change: Y316D

DomainStartEndE-ValueType
Pfam:7tm_1 43 304 7.6e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128349
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the G-protein coupled receptor family. This protein is a receptor for prostaglandin F2-alpha (PGF2-alpha), which is known to be a potent luteolytic agent, and may also be involved in modulating intraocular pressure and smooth muscle contraction in uterus. Knockout studies in mice suggest that the interaction of PGF2-alpha with this receptor may initiate parturition in ovarian luteal cells and thus induce luteolysis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Pregnant females homozygous for a targeted null mutation are unable to deliver their offspring due to lack of induction of the oxytocin receptor and fail to show the normal decline of serum progesterone levels preceding parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Atpaf1 A T 4: 115,796,757 K201N possibly damaging Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gm6741 T A 17: 91,236,996 H62Q probably benign Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Itgb1 G A 8: 128,720,065 C401Y probably damaging Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Nabp1 T C 1: 51,471,352 N164D possibly damaging Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Olfr346 T G 2: 36,688,309 Y102* probably null Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Pecam1 T C 11: 106,681,079 D554G probably benign Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Pop1 C A 15: 34,530,210 A918D possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Slc17a6 G A 7: 51,646,277 probably benign Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r27 T G 6: 124,223,934 I355L probably benign Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zbtb18 T C 1: 177,447,170 L23P probably damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Ptgfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Ptgfr APN 3 151835686 missense probably benign 0.43
IGL02085:Ptgfr APN 3 151835800 missense probably benign 0.00
IGL02110:Ptgfr APN 3 151835460 missense probably damaging 0.97
IGL02971:Ptgfr APN 3 151835326 missense probably benign 0.00
IGL03263:Ptgfr APN 3 151835863 missense probably benign 0.00
R0048:Ptgfr UTSW 3 151835091 missense possibly damaging 0.51
R0048:Ptgfr UTSW 3 151835091 missense possibly damaging 0.51
R0602:Ptgfr UTSW 3 151835202 missense probably damaging 1.00
R0624:Ptgfr UTSW 3 151835202 missense probably damaging 1.00
R0633:Ptgfr UTSW 3 151801763 missense probably benign 0.00
R1930:Ptgfr UTSW 3 151835194 missense probably benign 0.16
R1931:Ptgfr UTSW 3 151835194 missense probably benign 0.16
R1989:Ptgfr UTSW 3 151835339 nonsense probably null
R4596:Ptgfr UTSW 3 151801793 missense probably damaging 1.00
R5899:Ptgfr UTSW 3 151835101 missense probably damaging 0.96
R6295:Ptgfr UTSW 3 151835289 missense probably benign 0.00
R6907:Ptgfr UTSW 3 151835301 missense possibly damaging 0.95
R7047:Ptgfr UTSW 3 151835541 missense possibly damaging 0.74
R7320:Ptgfr UTSW 3 151835397 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AGCTTCACTCGATGCTTGCTGG -3'
(R):5'- CAACATGGCAGCACTTTGTGAGATG -3'

Sequencing Primer
(F):5'- CGATGCTTGCTGGCTCTC -3'
(R):5'- GTTGTCAACTTGAAAAACTGTGGG -3'
Posted On2014-04-24