Incidental Mutation 'R1614:Slc17a6'
ID176997
Institutional Source Beutler Lab
Gene Symbol Slc17a6
Ensembl Gene ENSMUSG00000030500
Gene Namesolute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6
Synonyms2900073D12Rik, VGLUT2
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1614 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location51622006-51671119 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 51646277 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032710] [ENSMUST00000207945]
Predicted Effect probably benign
Transcript: ENSMUST00000032710
SMART Domains Protein: ENSMUSP00000032710
Gene: ENSMUSG00000030500

DomainStartEndE-ValueType
Pfam:MFS_1 76 461 6.5e-50 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207375
Predicted Effect probably benign
Transcript: ENSMUST00000207945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208597
Meta Mutation Damage Score 0.0844 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations display neonatal lethality, respiratory failure, and abnormal nervous system physiology. Heterozygous mice for one allele display abnormal miniature EPSC and reduced responses to neuropathic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Atpaf1 A T 4: 115,796,757 K201N possibly damaging Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gm6741 T A 17: 91,236,996 H62Q probably benign Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Itgb1 G A 8: 128,720,065 C401Y probably damaging Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Nabp1 T C 1: 51,471,352 N164D possibly damaging Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Olfr346 T G 2: 36,688,309 Y102* probably null Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Pecam1 T C 11: 106,681,079 D554G probably benign Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Pop1 C A 15: 34,530,210 A918D possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ptgfr A C 3: 151,801,779 Y316D probably benign Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r27 T G 6: 124,223,934 I355L probably benign Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zbtb18 T C 1: 177,447,170 L23P probably damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Slc17a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01408:Slc17a6 APN 7 51669115 missense probably benign 0.15
IGL01653:Slc17a6 APN 7 51668022 missense possibly damaging 0.92
IGL01993:Slc17a6 APN 7 51667957 missense possibly damaging 0.51
IGL02082:Slc17a6 APN 7 51669029 missense probably benign 0.00
IGL02212:Slc17a6 APN 7 51667470 missense possibly damaging 0.94
IGL02544:Slc17a6 APN 7 51666155 nonsense probably null
IGL02585:Slc17a6 APN 7 51625349 missense probably benign 0.00
IGL03206:Slc17a6 APN 7 51666023 splice site probably benign
IGL03396:Slc17a6 APN 7 51669092 missense probably damaging 1.00
R0137:Slc17a6 UTSW 7 51666144 missense probably benign 0.00
R0141:Slc17a6 UTSW 7 51669067 missense probably benign 0.10
R0207:Slc17a6 UTSW 7 51646180 intron probably benign
R0362:Slc17a6 UTSW 7 51658771 missense probably damaging 1.00
R0841:Slc17a6 UTSW 7 51625315 missense probably benign 0.29
R1037:Slc17a6 UTSW 7 51649248 splice site probably benign
R1325:Slc17a6 UTSW 7 51661552 missense probably benign 0.15
R1625:Slc17a6 UTSW 7 51661460 missense probably benign 0.00
R1736:Slc17a6 UTSW 7 51661585 splice site probably benign
R1777:Slc17a6 UTSW 7 51646209 missense possibly damaging 0.63
R1824:Slc17a6 UTSW 7 51661546 missense probably damaging 1.00
R2249:Slc17a6 UTSW 7 51667906 missense probably damaging 1.00
R4283:Slc17a6 UTSW 7 51645076 missense probably damaging 1.00
R4910:Slc17a6 UTSW 7 51658741 missense possibly damaging 0.78
R5301:Slc17a6 UTSW 7 51658771 missense probably damaging 1.00
R5523:Slc17a6 UTSW 7 51626850 nonsense probably null
R5570:Slc17a6 UTSW 7 51658756 missense probably benign 0.00
R5720:Slc17a6 UTSW 7 51625397 missense probably damaging 1.00
R5736:Slc17a6 UTSW 7 51645093 missense possibly damaging 0.78
R5765:Slc17a6 UTSW 7 51625501 missense possibly damaging 0.93
R6380:Slc17a6 UTSW 7 51667463 missense probably benign 0.02
R6989:Slc17a6 UTSW 7 51661476 missense possibly damaging 0.88
R7178:Slc17a6 UTSW 7 51667511 missense possibly damaging 0.58
R7194:Slc17a6 UTSW 7 51626892 missense probably damaging 1.00
R7325:Slc17a6 UTSW 7 51645018 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCACTAAGCGCCAGTAGATTAGAAACG -3'
(R):5'- TGAGACTTTTCTTGCCTATTTGGGACTC -3'

Sequencing Primer
(F):5'- TTAGAAACGGGCTCCGTG -3'
(R):5'- tcaggaggcagaggcag -3'
Posted On2014-04-24