Incidental Mutation 'R1614:Itgb1'
ID177001
Institutional Source Beutler Lab
Gene Symbol Itgb1
Ensembl Gene ENSMUSG00000025809
Gene Nameintegrin beta 1 (fibronectin receptor beta)
SynonymsGm9863, Fnrb, CD29, 4633401G24Rik, beta1 integrin
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1614 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location128685654-128733200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128720065 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 401 (C401Y)
Ref Sequence ENSEMBL: ENSMUSP00000087457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090006] [ENSMUST00000124826]
Predicted Effect probably damaging
Transcript: ENSMUST00000090006
AA Change: C401Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087457
Gene: ENSMUSG00000025809
AA Change: C401Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PSI 26 76 3.01e-7 SMART
INB 34 464 2e-298 SMART
VWA 142 372 1.45e0 SMART
low complexity region 568 581 N/A INTRINSIC
Pfam:EGF_2 599 630 8.8e-8 PFAM
Integrin_B_tail 640 728 4.58e-37 SMART
transmembrane domain 729 751 N/A INTRINSIC
Integrin_b_cyt 752 798 3.43e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124826
SMART Domains Protein: ENSMUSP00000120026
Gene: ENSMUSG00000025809

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3VI4|D 21 51 2e-16 PDB
Blast:PSI 26 51 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149116
SMART Domains Protein: ENSMUSP00000119699
Gene: ENSMUSG00000025809

DomainStartEndE-ValueType
Pfam:Integrin_B_tail 1 39 1.9e-12 PFAM
transmembrane domain 40 62 N/A INTRINSIC
Integrin_b_cyt 63 109 8.77e-25 SMART
Meta Mutation Damage Score 0.688 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric proteins made up of alpha and beta subunits. At least 18 alpha and 8 beta subunits have been described in mammals. Integrin family members are membrane receptors involved in cell adhesion and recognition in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic diffusion of tumor cells. This gene encodes a beta subunit. Multiple alternatively spliced transcript variants which encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants die at or soon after implantation. Tissue-specific knockouts exhibit skin blisters, hair-loss, brain and heart defects, and impaired immune responses, wound healing, and hematopoietic stem cell migration, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Atpaf1 A T 4: 115,796,757 K201N possibly damaging Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gm6741 T A 17: 91,236,996 H62Q probably benign Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Nabp1 T C 1: 51,471,352 N164D possibly damaging Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Olfr346 T G 2: 36,688,309 Y102* probably null Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Pecam1 T C 11: 106,681,079 D554G probably benign Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Pop1 C A 15: 34,530,210 A918D possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ptgfr A C 3: 151,801,779 Y316D probably benign Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Slc17a6 G A 7: 51,646,277 probably benign Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r27 T G 6: 124,223,934 I355L probably benign Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zbtb18 T C 1: 177,447,170 L23P probably damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Itgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Itgb1 APN 8 128713918 splice site probably benign
IGL01407:Itgb1 APN 8 128722834 missense probably benign 0.08
IGL03025:Itgb1 APN 8 128722584 missense possibly damaging 0.96
PIT4377001:Itgb1 UTSW 8 128710383 missense probably damaging 1.00
R0136:Itgb1 UTSW 8 128722854 missense possibly damaging 0.96
R0244:Itgb1 UTSW 8 128717685 splice site probably benign
R0483:Itgb1 UTSW 8 128726167 missense possibly damaging 0.79
R0606:Itgb1 UTSW 8 128722372 unclassified probably benign
R0657:Itgb1 UTSW 8 128722854 missense possibly damaging 0.96
R0865:Itgb1 UTSW 8 128710251 critical splice acceptor site probably null
R1052:Itgb1 UTSW 8 128713305 missense probably damaging 1.00
R1429:Itgb1 UTSW 8 128717676 critical splice donor site probably null
R1589:Itgb1 UTSW 8 128705458 missense probably damaging 0.99
R1589:Itgb1 UTSW 8 128705459 missense possibly damaging 0.95
R1672:Itgb1 UTSW 8 128732045 missense probably damaging 1.00
R1723:Itgb1 UTSW 8 128726038 missense probably damaging 0.98
R1865:Itgb1 UTSW 8 128720457 missense probably benign 0.01
R3786:Itgb1 UTSW 8 128713358 missense probably damaging 1.00
R4223:Itgb1 UTSW 8 128714143 missense probably damaging 1.00
R4756:Itgb1 UTSW 8 128717222 missense probably damaging 0.98
R4826:Itgb1 UTSW 8 128720308 missense probably damaging 1.00
R4880:Itgb1 UTSW 8 128716150 missense probably damaging 1.00
R5202:Itgb1 UTSW 8 128720010 missense probably damaging 0.99
R5682:Itgb1 UTSW 8 128727068 splice site probably null
R5935:Itgb1 UTSW 8 128713237 nonsense probably null
R6156:Itgb1 UTSW 8 128732054 missense possibly damaging 0.79
R6160:Itgb1 UTSW 8 128720283 missense possibly damaging 0.95
R6248:Itgb1 UTSW 8 128722421 missense possibly damaging 0.80
R6812:Itgb1 UTSW 8 128705410 splice site probably null
R6869:Itgb1 UTSW 8 128720035 missense probably benign 0.01
R7249:Itgb1 UTSW 8 128720404 missense probably benign 0.28
R7496:Itgb1 UTSW 8 128720305 missense not run
Z1088:Itgb1 UTSW 8 128713369 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCCTTTCATCCATTGTTGTGTGAGTG -3'
(R):5'- CTTCTTCAGTGAAGCCCAGAGGTTTAAT -3'

Sequencing Primer
(F):5'- CATCCATTGTTGTGTGAGTGTATCC -3'
(R):5'- ATGGTTTCAGACTCCTTATTTGGAC -3'
Posted On2014-04-24