Incidental Mutation 'R1614:Rnf43'
ID177007
Institutional Source Beutler Lab
Gene Symbol Rnf43
Ensembl Gene ENSMUSG00000034177
Gene Namering finger protein 43
Synonyms
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R1614 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87662722-87735539 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 87731659 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 529 (R529*)
Ref Sequence ENSEMBL: ENSMUSP00000130685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040089] [ENSMUST00000092800] [ENSMUST00000121782] [ENSMUST00000165679]
Predicted Effect probably null
Transcript: ENSMUST00000040089
AA Change: R402*
SMART Domains Protein: ENSMUSP00000044241
Gene: ENSMUSG00000034177
AA Change: R402*

DomainStartEndE-ValueType
PDB:4KNG|F 1 71 7e-32 PDB
transmembrane domain 72 91 N/A INTRINSIC
RING 145 185 6.43e-8 SMART
low complexity region 337 351 N/A INTRINSIC
low complexity region 366 376 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
low complexity region 646 654 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092800
AA Change: R529*
SMART Domains Protein: ENSMUSP00000090476
Gene: ENSMUSG00000034177
AA Change: R529*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 198 6e-93 PDB
transmembrane domain 199 218 N/A INTRINSIC
RING 272 312 6.43e-8 SMART
low complexity region 464 478 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
low complexity region 618 643 N/A INTRINSIC
low complexity region 773 781 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121782
AA Change: R488*
SMART Domains Protein: ENSMUSP00000112748
Gene: ENSMUSG00000034177
AA Change: R488*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 157 6e-54 PDB
transmembrane domain 158 177 N/A INTRINSIC
RING 231 271 6.43e-8 SMART
low complexity region 423 437 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 577 602 N/A INTRINSIC
low complexity region 732 740 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162740
Predicted Effect probably null
Transcript: ENSMUST00000165679
AA Change: R529*
SMART Domains Protein: ENSMUSP00000130685
Gene: ENSMUSG00000034177
AA Change: R529*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 198 6e-93 PDB
transmembrane domain 199 218 N/A INTRINSIC
RING 272 312 6.43e-8 SMART
low complexity region 464 478 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
low complexity region 618 643 N/A INTRINSIC
low complexity region 773 781 N/A INTRINSIC
Meta Mutation Damage Score 0.6244 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RING-type E3 ubiquitin ligase and is predicted to contain a transmembrane domain, a protease-associated domain, an ectodomain, and a cytoplasmic RING domain. This protein is thought to negatively regulate Wnt signaling, and expression of this gene results in an increase in ubiquitination of frizzled receptors, an alteration in their subcellular distribution, resulting in reduced surface levels of these receptors. Mutations in this gene have been reported in multiple tumor cells, including colorectal and endometrial cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Atpaf1 A T 4: 115,796,757 K201N possibly damaging Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gm6741 T A 17: 91,236,996 H62Q probably benign Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Itgb1 G A 8: 128,720,065 C401Y probably damaging Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Nabp1 T C 1: 51,471,352 N164D possibly damaging Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Olfr346 T G 2: 36,688,309 Y102* probably null Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Pecam1 T C 11: 106,681,079 D554G probably benign Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Pop1 C A 15: 34,530,210 A918D possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ptgfr A C 3: 151,801,779 Y316D probably benign Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Slc17a6 G A 7: 51,646,277 probably benign Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r27 T G 6: 124,223,934 I355L probably benign Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zbtb18 T C 1: 177,447,170 L23P probably damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Rnf43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Rnf43 APN 11 87731892 missense probably benign 0.15
IGL01520:Rnf43 APN 11 87664716 missense probably damaging 1.00
IGL01541:Rnf43 APN 11 87730220 missense probably null 1.00
IGL01784:Rnf43 APN 11 87731806 missense possibly damaging 0.56
IGL02037:Rnf43 APN 11 87731653 missense probably benign 0.00
IGL02725:Rnf43 APN 11 87731585 missense probably damaging 1.00
IGL03062:Rnf43 APN 11 87732304 nonsense probably null
R0226:Rnf43 UTSW 11 87731437 missense probably damaging 1.00
R0391:Rnf43 UTSW 11 87731282 missense possibly damaging 0.86
R0834:Rnf43 UTSW 11 87731251 missense probably benign
R1163:Rnf43 UTSW 11 87729513 missense probably damaging 0.98
R1203:Rnf43 UTSW 11 87727475 splice site probably benign
R1314:Rnf43 UTSW 11 87732319 missense probably benign
R1404:Rnf43 UTSW 11 87734177 missense possibly damaging 0.82
R1404:Rnf43 UTSW 11 87734177 missense possibly damaging 0.82
R1469:Rnf43 UTSW 11 87731407 missense probably damaging 1.00
R1469:Rnf43 UTSW 11 87731407 missense probably damaging 1.00
R1511:Rnf43 UTSW 11 87731347 missense probably benign 0.00
R1513:Rnf43 UTSW 11 87729431 missense probably damaging 1.00
R1615:Rnf43 UTSW 11 87731659 nonsense probably null
R2341:Rnf43 UTSW 11 87732025 missense probably damaging 0.96
R2410:Rnf43 UTSW 11 87732259 missense possibly damaging 0.94
R2847:Rnf43 UTSW 11 87732267 missense probably benign 0.04
R2849:Rnf43 UTSW 11 87732267 missense probably benign 0.04
R5567:Rnf43 UTSW 11 87727445 missense probably damaging 1.00
R5943:Rnf43 UTSW 11 87731735 missense probably damaging 1.00
R6135:Rnf43 UTSW 11 87732125 missense probably damaging 1.00
R6452:Rnf43 UTSW 11 87732253 missense probably damaging 1.00
R6511:Rnf43 UTSW 11 87732163 missense probably benign 0.01
R7426:Rnf43 UTSW 11 87731852 missense probably benign 0.03
X0064:Rnf43 UTSW 11 87727342 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AATCGCCTCCGATGTACCTCTCAG -3'
(R):5'- TTTCTGCAAGTTCAAAAGACCGCTG -3'

Sequencing Primer
(F):5'- CAGAACGCAGCGGTTACTTG -3'
(R):5'- ttgggactggggctagg -3'
Posted On2014-04-24