Incidental Mutation 'R1614:Pop1'
ID177017
Institutional Source Beutler Lab
Gene Symbol Pop1
Ensembl Gene ENSMUSG00000022325
Gene Nameprocessing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms4932434G09Rik
MMRRC Submission 039651-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R1614 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location34495304-34530648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34530210 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 918 (A918D)
Ref Sequence ENSEMBL: ENSMUSP00000078037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052290] [ENSMUST00000079028]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052290
AA Change: A948D

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052654
Gene: ENSMUSG00000022325
AA Change: A948D

DomainStartEndE-ValueType
Pfam:POP1 107 190 6.2e-21 PFAM
Pfam:POP1 179 257 2.5e-23 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 647 738 1.4e-30 PFAM
low complexity region 931 940 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079028
AA Change: A918D

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078037
Gene: ENSMUSG00000022325
AA Change: A918D

DomainStartEndE-ValueType
Pfam:POP1 107 258 1e-46 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 617 708 1.2e-34 PFAM
low complexity region 901 910 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226504
Meta Mutation Damage Score 0.0564 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.4%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein subunit of two different small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is a ribonuclease that localizes to the nucleus and functions in pre-RNA processing. This protein is also an autoantigen in patients suffering from connective tissue diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik T G 11: 85,172,864 S28A possibly damaging Het
Arl9 A G 5: 77,010,565 T165A probably benign Het
Atpaf1 A T 4: 115,796,757 K201N possibly damaging Het
Cacna1b G T 2: 24,690,807 Q676K possibly damaging Het
Ccdc88c A T 12: 100,912,984 H1959Q probably benign Het
Cep162 T C 9: 87,212,932 D808G probably damaging Het
Chtf18 A G 17: 25,727,090 L42P probably benign Het
Cox7c A G 13: 86,045,785 F40L probably benign Het
Dock7 C T 4: 99,061,280 V442I probably benign Het
Dst T C 1: 34,275,263 F4198S probably damaging Het
Fam13a T A 6: 58,940,184 D569V probably damaging Het
Gm6741 T A 17: 91,236,996 H62Q probably benign Het
Gnptab A G 10: 88,414,589 T172A probably benign Het
Greb1 A G 12: 16,701,171 S1013P probably damaging Het
Insl5 A T 4: 103,026,649 L25* probably null Het
Ipo13 A G 4: 117,904,618 S462P probably benign Het
Itgb1 G A 8: 128,720,065 C401Y probably damaging Het
Kcnh7 G T 2: 62,850,604 A213E probably benign Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Mesp2 T C 7: 79,811,619 S231P probably benign Het
Nabp1 T C 1: 51,471,352 N164D possibly damaging Het
Nop53 A G 7: 15,945,965 V30A probably benign Het
Olfr1246 T A 2: 89,590,696 I140L possibly damaging Het
Olfr1278 T A 2: 111,293,066 V266E probably damaging Het
Olfr1318 T A 2: 112,156,517 C189S probably damaging Het
Olfr346 T G 2: 36,688,309 Y102* probably null Het
Pcsk5 G A 19: 17,515,256 R918C probably damaging Het
Pecam1 T C 11: 106,681,079 D554G probably benign Het
Polr2a T C 11: 69,743,373 I744V possibly damaging Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prmt3 A T 7: 49,826,719 I359F possibly damaging Het
Proz G A 8: 13,066,904 C152Y probably damaging Het
Ptgfr A C 3: 151,801,779 Y316D probably benign Het
Ralgapa2 G T 2: 146,388,612 S1011Y probably damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Slc17a6 G A 7: 51,646,277 probably benign Het
Slc25a19 A T 11: 115,616,623 C224* probably null Het
Smarcd3 A G 5: 24,594,876 S299P possibly damaging Het
Stard9 T C 2: 120,697,675 F1471S possibly damaging Het
Strada A C 11: 106,168,319 V211G probably damaging Het
Tom1l1 T C 11: 90,683,254 E68G probably damaging Het
Vmn2r27 T G 6: 124,223,934 I355L probably benign Het
Vmn2r68 A T 7: 85,221,738 M779K possibly damaging Het
Zbtb18 T C 1: 177,447,170 L23P probably damaging Het
Zfp112 G T 7: 24,126,599 C664F probably damaging Het
Zfp955a A T 17: 33,242,332 N275K possibly damaging Het
Other mutations in Pop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Pop1 APN 15 34508729 missense probably benign 0.00
IGL02192:Pop1 APN 15 34529071 missense probably benign 0.08
IGL02680:Pop1 APN 15 34502473 missense probably damaging 0.99
IGL02958:Pop1 APN 15 34530363 missense probably damaging 0.99
H8562:Pop1 UTSW 15 34530212 missense probably benign 0.00
PIT4802001:Pop1 UTSW 15 34529083 missense probably benign 0.00
R0244:Pop1 UTSW 15 34515891 nonsense probably null
R0281:Pop1 UTSW 15 34529858 splice site probably null
R0453:Pop1 UTSW 15 34526206 missense possibly damaging 0.82
R0579:Pop1 UTSW 15 34509969 missense possibly damaging 0.68
R1054:Pop1 UTSW 15 34509809 missense probably benign 0.30
R1501:Pop1 UTSW 15 34510357 missense probably benign 0.01
R1994:Pop1 UTSW 15 34530471 missense probably damaging 1.00
R2084:Pop1 UTSW 15 34508598 splice site probably benign
R4020:Pop1 UTSW 15 34508780 missense probably benign 0.01
R4550:Pop1 UTSW 15 34528936 missense probably damaging 1.00
R4579:Pop1 UTSW 15 34515824 intron probably benign
R5672:Pop1 UTSW 15 34530179 missense possibly damaging 0.63
R6139:Pop1 UTSW 15 34529058 missense probably benign 0.26
R6161:Pop1 UTSW 15 34526310 missense probably damaging 1.00
R6821:Pop1 UTSW 15 34508639 missense possibly damaging 0.86
R7053:Pop1 UTSW 15 34530275 missense probably benign 0.01
R7195:Pop1 UTSW 15 34510379 missense probably damaging 0.97
Z1088:Pop1 UTSW 15 34499319 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGAATGACTTCCCCAGAGCCC -3'
(R):5'- GGACAACATTTCCAGCAAGCCG -3'

Sequencing Primer
(F):5'- CTTGTCCCTGCTCAGGAAG -3'
(R):5'- TTCCAGCAAGCCGGTCATAC -3'
Posted On2014-04-24