Incidental Mutation 'R1615:Tnn'
ID177027
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Nametenascin N
SynonymsTnw, tenascin-W
MMRRC Submission 039652-MU
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R1615 (G1)
Quality Score197
Status Validated
Chromosome1
Chromosomal Location160085029-160153580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160118408 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 947 (Y947H)
Ref Sequence ENSEMBL: ENSMUSP00000039452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039178
AA Change: Y947H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: Y947H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131919
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (64/65)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C T 9: 58,499,068 A87V probably damaging Het
Adcy8 A T 15: 64,871,776 C328S probably benign Het
Adgrv1 G T 13: 81,424,288 T4918K probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Amer3 T C 1: 34,588,171 M497T probably damaging Het
Arid2 C T 15: 96,371,654 T1216M possibly damaging Het
Birc6 A G 17: 74,609,409 probably null Het
Bzw2 A G 12: 36,119,127 probably benign Het
Ccr1 T C 9: 123,963,536 H319R probably benign Het
Dnah11 A G 12: 118,050,722 I2010T probably damaging Het
Dnhd1 A G 7: 105,703,206 Y2522C probably benign Het
Dnhd1 T A 7: 105,713,706 I3825K possibly damaging Het
Dst A T 1: 34,199,371 D3718V probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Fbxw21 T C 9: 109,143,726 Y380C probably damaging Het
Fhad1 G A 4: 141,922,323 T836M probably damaging Het
Fhod1 C T 8: 105,347,831 probably benign Het
Flt1 A G 5: 147,639,288 C637R probably damaging Het
Fmnl2 A G 2: 53,118,424 K809E probably damaging Het
Grm1 G T 10: 10,741,508 Y510* probably null Het
Hey1 A T 3: 8,664,838 H186Q possibly damaging Het
Itga2b C T 11: 102,460,137 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lmcd1 A G 6: 112,273,950 D7G probably benign Het
Lrrc1 T C 9: 77,435,118 D358G possibly damaging Het
Lyn A G 4: 3,748,765 K248E probably benign Het
Map4k4 A G 1: 40,006,830 probably benign Het
Map4k5 A T 12: 69,844,413 L160H probably damaging Het
Myo6 C T 9: 80,307,725 R1247C probably damaging Het
Myo9a A G 9: 59,788,456 E347G possibly damaging Het
Ndfip1 C T 18: 38,460,619 P213S probably benign Het
Neurl3 T C 1: 36,269,389 E114G possibly damaging Het
Nlrp14 A T 7: 107,196,163 I877F probably benign Het
Obscn A G 11: 59,099,825 S1733P probably benign Het
Oxgr1 A T 14: 120,022,773 S7R probably benign Het
Plcb1 A T 2: 135,362,444 probably benign Het
Prkag2 G T 5: 24,875,178 N120K possibly damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Saraf A G 8: 34,165,288 K174E possibly damaging Het
Scrib T C 15: 76,066,205 Q264R probably benign Het
Sh3rf3 T A 10: 59,131,077 M747K probably benign Het
Shf T C 2: 122,349,432 H421R probably damaging Het
Slc35g3 A G 11: 69,760,542 S228P probably damaging Het
Slit1 A G 19: 41,650,671 probably benign Het
Soga1 T G 2: 157,020,743 H1422P probably damaging Het
Srrm4 A G 5: 116,447,300 probably benign Het
Stfa1 T G 16: 36,280,467 V23G probably damaging Het
Swap70 A G 7: 110,273,291 D371G probably benign Het
Tada2a T C 11: 84,103,100 D186G probably damaging Het
Tdpoz3 C A 3: 93,826,311 Q98K probably benign Het
Tgfbrap1 A G 1: 43,051,985 V660A probably benign Het
Trim60 A T 8: 65,000,510 C362* probably null Het
Vmn1r81 T A 7: 12,260,514 N56Y probably damaging Het
Vsig8 A G 1: 172,559,713 D52G probably damaging Het
Wdfy4 G A 14: 33,042,512 R2140C probably damaging Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1565:Tnn UTSW 1 160097265 missense probably damaging 1.00
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 synonymous probably null
R2196:Tnn UTSW 1 160097228 nonsense probably null
R2225:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4588:Tnn UTSW 1 160145111 missense probably benign 0.25
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6324:Tnn UTSW 1 160145204 missense probably damaging 0.96
R6455:Tnn UTSW 1 160114719 missense probably damaging 1.00
R6563:Tnn UTSW 1 160088398 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7157:Tnn UTSW 1 160126377 nonsense probably null
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTGTTCCAAAGAGAGCACAGC -3'
(R):5'- ACCGAGACCACTCTTAGTGTCTCC -3'

Sequencing Primer
(F):5'- GTATATGGCTCACAGATCCTAGC -3'
(R):5'- CCTGGGACCCAGTGGAG -3'
Posted On2014-04-24