Incidental Mutation 'R1615:Fmnl2'
ID177029
Institutional Source Beutler Lab
Gene Symbol Fmnl2
Ensembl Gene ENSMUSG00000036053
Gene Nameformin-like 2
Synonyms5430425K04Rik, man
MMRRC Submission 039652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1615 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location52857860-53133804 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53118424 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 809 (K809E)
Ref Sequence ENSEMBL: ENSMUSP00000057084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049483] [ENSMUST00000050719] [ENSMUST00000090952] [ENSMUST00000127122] [ENSMUST00000155586]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049483
AA Change: K843E

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047260
Gene: ENSMUSG00000036053
AA Change: K843E

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 8e-3 SMART
FH2 615 1052 1.66e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000050719
AA Change: K809E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057084
Gene: ENSMUSG00000036053
AA Change: K809E

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
low complexity region 549 568 N/A INTRINSIC
FH2 581 1018 1.66e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090952
AA Change: K843E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088472
Gene: ENSMUSG00000036053
AA Change: K843E

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 6e-3 SMART
FH2 615 1052 1.66e-124 SMART
low complexity region 1063 1075 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127122
AA Change: K843E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118658
Gene: ENSMUSG00000036053
AA Change: K843E

DomainStartEndE-ValueType
Drf_GBD 23 275 1.19e-96 SMART
Drf_FH3 278 482 8.68e-76 SMART
low complexity region 518 540 N/A INTRINSIC
SCOP:d1jvr__ 549 588 7e-3 SMART
FH2 615 1052 1.66e-124 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155586
AA Change: K843E

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117822
Gene: ENSMUSG00000036053
AA Change: K843E

DomainStartEndE-ValueType
Pfam:FH2 1 131 2e-33 PFAM
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a formin-related protein. Formin-related proteins have been implicated in morphogenesis, cytokinesis, and cell polarity. Alternatively spliced transcript variants encoding different isoforms have been described but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C T 9: 58,499,068 A87V probably damaging Het
Adcy8 A T 15: 64,871,776 C328S probably benign Het
Adgrv1 G T 13: 81,424,288 T4918K probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Amer3 T C 1: 34,588,171 M497T probably damaging Het
Arid2 C T 15: 96,371,654 T1216M possibly damaging Het
Birc6 A G 17: 74,609,409 probably null Het
Bzw2 A G 12: 36,119,127 probably benign Het
Ccr1 T C 9: 123,963,536 H319R probably benign Het
Dnah11 A G 12: 118,050,722 I2010T probably damaging Het
Dnhd1 A G 7: 105,703,206 Y2522C probably benign Het
Dnhd1 T A 7: 105,713,706 I3825K possibly damaging Het
Dst A T 1: 34,199,371 D3718V probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Fbxw21 T C 9: 109,143,726 Y380C probably damaging Het
Fhad1 G A 4: 141,922,323 T836M probably damaging Het
Fhod1 C T 8: 105,347,831 probably benign Het
Flt1 A G 5: 147,639,288 C637R probably damaging Het
Grm1 G T 10: 10,741,508 Y510* probably null Het
Hey1 A T 3: 8,664,838 H186Q possibly damaging Het
Itga2b C T 11: 102,460,137 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lmcd1 A G 6: 112,273,950 D7G probably benign Het
Lrrc1 T C 9: 77,435,118 D358G possibly damaging Het
Lyn A G 4: 3,748,765 K248E probably benign Het
Map4k4 A G 1: 40,006,830 probably benign Het
Map4k5 A T 12: 69,844,413 L160H probably damaging Het
Myo6 C T 9: 80,307,725 R1247C probably damaging Het
Myo9a A G 9: 59,788,456 E347G possibly damaging Het
Ndfip1 C T 18: 38,460,619 P213S probably benign Het
Neurl3 T C 1: 36,269,389 E114G possibly damaging Het
Nlrp14 A T 7: 107,196,163 I877F probably benign Het
Obscn A G 11: 59,099,825 S1733P probably benign Het
Oxgr1 A T 14: 120,022,773 S7R probably benign Het
Plcb1 A T 2: 135,362,444 probably benign Het
Prkag2 G T 5: 24,875,178 N120K possibly damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Saraf A G 8: 34,165,288 K174E possibly damaging Het
Scrib T C 15: 76,066,205 Q264R probably benign Het
Sh3rf3 T A 10: 59,131,077 M747K probably benign Het
Shf T C 2: 122,349,432 H421R probably damaging Het
Slc35g3 A G 11: 69,760,542 S228P probably damaging Het
Slit1 A G 19: 41,650,671 probably benign Het
Soga1 T G 2: 157,020,743 H1422P probably damaging Het
Srrm4 A G 5: 116,447,300 probably benign Het
Stfa1 T G 16: 36,280,467 V23G probably damaging Het
Swap70 A G 7: 110,273,291 D371G probably benign Het
Tada2a T C 11: 84,103,100 D186G probably damaging Het
Tdpoz3 C A 3: 93,826,311 Q98K probably benign Het
Tgfbrap1 A G 1: 43,051,985 V660A probably benign Het
Tnn A G 1: 160,118,408 Y947H possibly damaging Het
Trim60 A T 8: 65,000,510 C362* probably null Het
Vmn1r81 T A 7: 12,260,514 N56Y probably damaging Het
Vsig8 A G 1: 172,559,713 D52G probably damaging Het
Wdfy4 G A 14: 33,042,512 R2140C probably damaging Het
Other mutations in Fmnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fmnl2 APN 2 53114917 missense probably damaging 1.00
IGL00960:Fmnl2 APN 2 53123482 missense probably damaging 0.98
IGL01343:Fmnl2 APN 2 53123545 missense probably damaging 1.00
IGL01790:Fmnl2 APN 2 53118368 missense probably damaging 1.00
IGL02555:Fmnl2 APN 2 53126851 critical splice acceptor site probably null
IGL02613:Fmnl2 APN 2 53073735 critical splice donor site probably null
IGL02712:Fmnl2 APN 2 53036498 splice site probably benign
IGL02715:Fmnl2 APN 2 53072210 missense possibly damaging 0.93
IGL02750:Fmnl2 APN 2 53103697 missense possibly damaging 0.95
IGL02832:Fmnl2 APN 2 52858249 missense possibly damaging 0.90
IGL02975:Fmnl2 APN 2 53101482 missense probably benign 0.45
PIT4280001:Fmnl2 UTSW 2 53118196 missense unknown
R0529:Fmnl2 UTSW 2 53042365 missense probably damaging 1.00
R0571:Fmnl2 UTSW 2 53054491 missense probably benign 0.01
R0707:Fmnl2 UTSW 2 53054486 missense possibly damaging 0.85
R1172:Fmnl2 UTSW 2 53072274 missense probably damaging 1.00
R1473:Fmnl2 UTSW 2 52858207 missense possibly damaging 0.53
R1533:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1536:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1537:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1547:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1548:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1549:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1604:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1608:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R1792:Fmnl2 UTSW 2 53042317 missense possibly damaging 0.79
R1965:Fmnl2 UTSW 2 53114868 missense probably damaging 1.00
R1970:Fmnl2 UTSW 2 53105576 missense possibly damaging 0.93
R2012:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2065:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2111:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2112:Fmnl2 UTSW 2 53105537 missense probably damaging 1.00
R2427:Fmnl2 UTSW 2 53116979 missense probably damaging 0.96
R4084:Fmnl2 UTSW 2 53107495 missense possibly damaging 0.96
R4095:Fmnl2 UTSW 2 53101523 missense probably damaging 0.99
R4607:Fmnl2 UTSW 2 53103716 missense possibly damaging 0.94
R4608:Fmnl2 UTSW 2 53103716 missense possibly damaging 0.94
R4720:Fmnl2 UTSW 2 53107540 missense possibly damaging 0.96
R4731:Fmnl2 UTSW 2 53117069 missense possibly damaging 0.95
R4947:Fmnl2 UTSW 2 53073710 missense probably benign 0.32
R5015:Fmnl2 UTSW 2 53103761 missense possibly damaging 0.85
R5402:Fmnl2 UTSW 2 53128782 missense probably damaging 0.97
R5731:Fmnl2 UTSW 2 53118137 intron probably null
R5766:Fmnl2 UTSW 2 53101454 missense probably damaging 1.00
R5945:Fmnl2 UTSW 2 53114199 missense probably damaging 0.99
R6093:Fmnl2 UTSW 2 53114868 missense probably damaging 1.00
R6210:Fmnl2 UTSW 2 53130445 missense possibly damaging 0.94
R6287:Fmnl2 UTSW 2 53014848 missense probably damaging 1.00
R6661:Fmnl2 UTSW 2 53108285 missense probably damaging 0.98
R6967:Fmnl2 UTSW 2 53097332 missense possibly damaging 0.88
R7006:Fmnl2 UTSW 2 53108254 missense probably benign 0.27
R7146:Fmnl2 UTSW 2 53068540 missense
R7173:Fmnl2 UTSW 2 53114190 missense unknown
R7176:Fmnl2 UTSW 2 53114150 missense unknown
R7182:Fmnl2 UTSW 2 53107441 missense unknown
R7201:Fmnl2 UTSW 2 53073654 missense unknown
R7470:Fmnl2 UTSW 2 53042365 missense probably damaging 1.00
R7481:Fmnl2 UTSW 2 53108431 missense unknown
Predicted Primers PCR Primer
(F):5'- ACGCAATTATAGCAGCATCCGTCTC -3'
(R):5'- GGTCCTTCCTGCCAAATGGTGTTTC -3'

Sequencing Primer
(F):5'- TATAGCAGCATCCGTCTCTATCAAG -3'
(R):5'- GGTGTTTCAGAAAATTTACACCAACC -3'
Posted On2014-04-24