Incidental Mutation 'R1615:Fhad1'
ID177038
Institutional Source Beutler Lab
Gene Symbol Fhad1
Ensembl Gene ENSMUSG00000051435
Gene Nameforkhead-associated (FHA) phosphopeptide binding domain 1
Synonyms
MMRRC Submission 039652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1615 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141890438-142015082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141922323 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 836 (T836M)
Ref Sequence ENSEMBL: ENSMUSP00000101406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036701] [ENSMUST00000105779] [ENSMUST00000105780]
Predicted Effect probably benign
Transcript: ENSMUST00000036701
AA Change: T171M

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000036224
Gene: ENSMUSG00000051435
AA Change: T171M

DomainStartEndE-ValueType
coiled coil region 31 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105779
AA Change: T836M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101405
Gene: ENSMUSG00000051435
AA Change: T836M

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105780
AA Change: T836M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101406
Gene: ENSMUSG00000051435
AA Change: T836M

DomainStartEndE-ValueType
FHA 17 69 8.41e-8 SMART
low complexity region 111 124 N/A INTRINSIC
coiled coil region 307 434 N/A INTRINSIC
coiled coil region 640 915 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
coiled coil region 1111 1140 N/A INTRINSIC
coiled coil region 1255 1339 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137618
Meta Mutation Damage Score 0.0336 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C T 9: 58,499,068 A87V probably damaging Het
Adcy8 A T 15: 64,871,776 C328S probably benign Het
Adgrv1 G T 13: 81,424,288 T4918K probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Amer3 T C 1: 34,588,171 M497T probably damaging Het
Arid2 C T 15: 96,371,654 T1216M possibly damaging Het
Birc6 A G 17: 74,609,409 probably null Het
Bzw2 A G 12: 36,119,127 probably benign Het
Ccr1 T C 9: 123,963,536 H319R probably benign Het
Dnah11 A G 12: 118,050,722 I2010T probably damaging Het
Dnhd1 A G 7: 105,703,206 Y2522C probably benign Het
Dnhd1 T A 7: 105,713,706 I3825K possibly damaging Het
Dst A T 1: 34,199,371 D3718V probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Fbxw21 T C 9: 109,143,726 Y380C probably damaging Het
Fhod1 C T 8: 105,347,831 probably benign Het
Flt1 A G 5: 147,639,288 C637R probably damaging Het
Fmnl2 A G 2: 53,118,424 K809E probably damaging Het
Grm1 G T 10: 10,741,508 Y510* probably null Het
Hey1 A T 3: 8,664,838 H186Q possibly damaging Het
Itga2b C T 11: 102,460,137 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lmcd1 A G 6: 112,273,950 D7G probably benign Het
Lrrc1 T C 9: 77,435,118 D358G possibly damaging Het
Lyn A G 4: 3,748,765 K248E probably benign Het
Map4k4 A G 1: 40,006,830 probably benign Het
Map4k5 A T 12: 69,844,413 L160H probably damaging Het
Myo6 C T 9: 80,307,725 R1247C probably damaging Het
Myo9a A G 9: 59,788,456 E347G possibly damaging Het
Ndfip1 C T 18: 38,460,619 P213S probably benign Het
Neurl3 T C 1: 36,269,389 E114G possibly damaging Het
Nlrp14 A T 7: 107,196,163 I877F probably benign Het
Obscn A G 11: 59,099,825 S1733P probably benign Het
Oxgr1 A T 14: 120,022,773 S7R probably benign Het
Plcb1 A T 2: 135,362,444 probably benign Het
Prkag2 G T 5: 24,875,178 N120K possibly damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Saraf A G 8: 34,165,288 K174E possibly damaging Het
Scrib T C 15: 76,066,205 Q264R probably benign Het
Sh3rf3 T A 10: 59,131,077 M747K probably benign Het
Shf T C 2: 122,349,432 H421R probably damaging Het
Slc35g3 A G 11: 69,760,542 S228P probably damaging Het
Slit1 A G 19: 41,650,671 probably benign Het
Soga1 T G 2: 157,020,743 H1422P probably damaging Het
Srrm4 A G 5: 116,447,300 probably benign Het
Stfa1 T G 16: 36,280,467 V23G probably damaging Het
Swap70 A G 7: 110,273,291 D371G probably benign Het
Tada2a T C 11: 84,103,100 D186G probably damaging Het
Tdpoz3 C A 3: 93,826,311 Q98K probably benign Het
Tgfbrap1 A G 1: 43,051,985 V660A probably benign Het
Tnn A G 1: 160,118,408 Y947H possibly damaging Het
Trim60 A T 8: 65,000,510 C362* probably null Het
Vmn1r81 T A 7: 12,260,514 N56Y probably damaging Het
Vsig8 A G 1: 172,559,713 D52G probably damaging Het
Wdfy4 G A 14: 33,042,512 R2140C probably damaging Het
Other mutations in Fhad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Fhad1 APN 4 141905612 missense probably benign 0.02
IGL01478:Fhad1 APN 4 141951638 missense possibly damaging 0.84
IGL01752:Fhad1 APN 4 141972899 missense possibly damaging 0.82
IGL01788:Fhad1 APN 4 141932802 missense probably benign 0.00
IGL01919:Fhad1 APN 4 141964595 missense probably damaging 0.96
IGL02489:Fhad1 APN 4 141957620 missense probably damaging 0.97
IGL02568:Fhad1 APN 4 141932794 missense probably null 1.00
IGL02583:Fhad1 APN 4 142011644 utr 5 prime probably benign
IGL02716:Fhad1 APN 4 141918331 missense possibly damaging 0.89
IGL02819:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL02820:Fhad1 APN 4 141918758 missense probably benign 0.23
IGL03038:Fhad1 APN 4 142002494 missense probably benign 0.38
IGL03167:Fhad1 APN 4 141972797 missense probably benign 0.00
IGL03255:Fhad1 APN 4 141972880 missense possibly damaging 0.79
PIT1430001:Fhad1 UTSW 4 141909749 missense probably damaging 0.99
R0014:Fhad1 UTSW 4 141928408 missense probably damaging 1.00
R0116:Fhad1 UTSW 4 141940095 missense probably benign 0.06
R0143:Fhad1 UTSW 4 141929646 splice site probably benign
R0178:Fhad1 UTSW 4 141955340 missense probably benign 0.31
R0308:Fhad1 UTSW 4 141985593 splice site probably benign
R0384:Fhad1 UTSW 4 142002426 missense probably benign
R0583:Fhad1 UTSW 4 141903990 missense probably benign 0.37
R1501:Fhad1 UTSW 4 141964625 missense probably benign
R1584:Fhad1 UTSW 4 141985511 missense probably benign 0.22
R1991:Fhad1 UTSW 4 141982162 missense possibly damaging 0.75
R2060:Fhad1 UTSW 4 141899249 missense probably benign 0.08
R2079:Fhad1 UTSW 4 141991202 nonsense probably null
R2133:Fhad1 UTSW 4 141928400 missense probably damaging 1.00
R2337:Fhad1 UTSW 4 141922344 missense possibly damaging 0.84
R2843:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2844:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2845:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2846:Fhad1 UTSW 4 141904968 missense probably benign 0.06
R2866:Fhad1 UTSW 4 141920788 missense probably benign 0.00
R3119:Fhad1 UTSW 4 141918307 frame shift probably null
R3760:Fhad1 UTSW 4 141909813 missense probably damaging 1.00
R4180:Fhad1 UTSW 4 141985543 missense possibly damaging 0.69
R4466:Fhad1 UTSW 4 141957658 missense probably damaging 1.00
R4627:Fhad1 UTSW 4 141896468 missense possibly damaging 0.47
R4680:Fhad1 UTSW 4 142011547 nonsense probably null
R4725:Fhad1 UTSW 4 141928378 critical splice donor site probably null
R4755:Fhad1 UTSW 4 141928483 missense probably damaging 1.00
R4831:Fhad1 UTSW 4 141916067 splice site probably null
R4909:Fhad1 UTSW 4 141985511 missense probably benign 0.01
R4968:Fhad1 UTSW 4 141918307 missense probably damaging 1.00
R5004:Fhad1 UTSW 4 142002599 critical splice acceptor site probably null
R5036:Fhad1 UTSW 4 141920741 missense probably benign 0.03
R5048:Fhad1 UTSW 4 141964676 critical splice acceptor site probably null
R5416:Fhad1 UTSW 4 141918802 missense probably benign 0.39
R5504:Fhad1 UTSW 4 141985535 missense probably benign
R5586:Fhad1 UTSW 4 141905131 missense probably benign 0.44
R5692:Fhad1 UTSW 4 141963457 missense probably benign 0.00
R5706:Fhad1 UTSW 4 141954116 missense probably damaging 1.00
R5773:Fhad1 UTSW 4 141929570 missense probably damaging 0.99
R5823:Fhad1 UTSW 4 141955306 missense possibly damaging 0.84
R5833:Fhad1 UTSW 4 142002527 missense probably damaging 1.00
R6170:Fhad1 UTSW 4 141890952 nonsense probably null
R6286:Fhad1 UTSW 4 141920898 missense probably damaging 1.00
R6610:Fhad1 UTSW 4 141916396 missense possibly damaging 0.94
R6755:Fhad1 UTSW 4 141964604 missense probably damaging 1.00
R7006:Fhad1 UTSW 4 141918291 frame shift probably null
R7008:Fhad1 UTSW 4 141918291 frame shift probably null
R7012:Fhad1 UTSW 4 141918291 frame shift probably null
R7014:Fhad1 UTSW 4 141918291 frame shift probably null
R7058:Fhad1 UTSW 4 141918291 frame shift probably null
R7059:Fhad1 UTSW 4 141918291 frame shift probably null
R7060:Fhad1 UTSW 4 141918291 frame shift probably null
R7159:Fhad1 UTSW 4 141951616 missense probably benign 0.01
R7472:Fhad1 UTSW 4 141964626 missense not run
X0018:Fhad1 UTSW 4 141951616 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCTCCTAGCACTGTGCATGAGC -3'
(R):5'- GCCTTAGAGGAGTAAATGCTGGCCTTG -3'

Sequencing Primer
(F):5'- caagtgttctcaactgaagttcc -3'
(R):5'- AAATGCTGGCCTTGCTGATTTG -3'
Posted On2014-04-24