Incidental Mutation 'R1615:Saraf'
ID177051
Institutional Source Beutler Lab
Gene Symbol Saraf
Ensembl Gene ENSMUSG00000031532
Gene Namestore-operated calcium entry-associated regulatory factor
SynonymsTmem66, 1810045K07Rik
MMRRC Submission 039652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R1615 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location34154575-34170821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34165288 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 174 (K174E)
Ref Sequence ENSEMBL: ENSMUSP00000033933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033933]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033933
AA Change: K174E

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033933
Gene: ENSMUSG00000031532
AA Change: K174E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:SARAF 48 363 4.8e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211664
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 88.8%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik C T 9: 58,499,068 A87V probably damaging Het
Adcy8 A T 15: 64,871,776 C328S probably benign Het
Adgrv1 G T 13: 81,424,288 T4918K probably benign Het
Aen T C 7: 78,905,912 Y108H probably damaging Het
Amer3 T C 1: 34,588,171 M497T probably damaging Het
Arid2 C T 15: 96,371,654 T1216M possibly damaging Het
Birc6 A G 17: 74,609,409 probably null Het
Bzw2 A G 12: 36,119,127 probably benign Het
Ccr1 T C 9: 123,963,536 H319R probably benign Het
Dnah11 A G 12: 118,050,722 I2010T probably damaging Het
Dnhd1 A G 7: 105,703,206 Y2522C probably benign Het
Dnhd1 T A 7: 105,713,706 I3825K possibly damaging Het
Dst A T 1: 34,199,371 D3718V probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Fbxw21 T C 9: 109,143,726 Y380C probably damaging Het
Fhad1 G A 4: 141,922,323 T836M probably damaging Het
Fhod1 C T 8: 105,347,831 probably benign Het
Flt1 A G 5: 147,639,288 C637R probably damaging Het
Fmnl2 A G 2: 53,118,424 K809E probably damaging Het
Grm1 G T 10: 10,741,508 Y510* probably null Het
Hey1 A T 3: 8,664,838 H186Q possibly damaging Het
Itga2b C T 11: 102,460,137 probably null Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Lmcd1 A G 6: 112,273,950 D7G probably benign Het
Lrrc1 T C 9: 77,435,118 D358G possibly damaging Het
Lyn A G 4: 3,748,765 K248E probably benign Het
Map4k4 A G 1: 40,006,830 probably benign Het
Map4k5 A T 12: 69,844,413 L160H probably damaging Het
Myo6 C T 9: 80,307,725 R1247C probably damaging Het
Myo9a A G 9: 59,788,456 E347G possibly damaging Het
Ndfip1 C T 18: 38,460,619 P213S probably benign Het
Neurl3 T C 1: 36,269,389 E114G possibly damaging Het
Nlrp14 A T 7: 107,196,163 I877F probably benign Het
Obscn A G 11: 59,099,825 S1733P probably benign Het
Oxgr1 A T 14: 120,022,773 S7R probably benign Het
Plcb1 A T 2: 135,362,444 probably benign Het
Prkag2 G T 5: 24,875,178 N120K possibly damaging Het
Rnf43 C T 11: 87,731,659 R529* probably null Het
Scrib T C 15: 76,066,205 Q264R probably benign Het
Sh3rf3 T A 10: 59,131,077 M747K probably benign Het
Shf T C 2: 122,349,432 H421R probably damaging Het
Slc35g3 A G 11: 69,760,542 S228P probably damaging Het
Slit1 A G 19: 41,650,671 probably benign Het
Soga1 T G 2: 157,020,743 H1422P probably damaging Het
Srrm4 A G 5: 116,447,300 probably benign Het
Stfa1 T G 16: 36,280,467 V23G probably damaging Het
Swap70 A G 7: 110,273,291 D371G probably benign Het
Tada2a T C 11: 84,103,100 D186G probably damaging Het
Tdpoz3 C A 3: 93,826,311 Q98K probably benign Het
Tgfbrap1 A G 1: 43,051,985 V660A probably benign Het
Tnn A G 1: 160,118,408 Y947H possibly damaging Het
Trim60 A T 8: 65,000,510 C362* probably null Het
Vmn1r81 T A 7: 12,260,514 N56Y probably damaging Het
Vsig8 A G 1: 172,559,713 D52G probably damaging Het
Wdfy4 G A 14: 33,042,512 R2140C probably damaging Het
Other mutations in Saraf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Saraf APN 8 34167808 missense probably benign 0.01
R2679:Saraf UTSW 8 34165274 missense probably damaging 1.00
R2899:Saraf UTSW 8 34161231 missense probably damaging 1.00
R2938:Saraf UTSW 8 34168581 missense probably benign 0.00
R4458:Saraf UTSW 8 34154716 missense unknown
R4661:Saraf UTSW 8 34168462 missense probably damaging 0.96
R4662:Saraf UTSW 8 34168462 missense probably damaging 0.96
R5029:Saraf UTSW 8 34161258 missense probably damaging 1.00
R5473:Saraf UTSW 8 34161258 missense probably damaging 1.00
R5627:Saraf UTSW 8 34154645 start codon destroyed probably null
R5776:Saraf UTSW 8 34165450 missense probably damaging 1.00
R5980:Saraf UTSW 8 34165387 missense probably benign 0.37
R6793:Saraf UTSW 8 34168613 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGCACCCAGTAGACCTAGTCTCTG -3'
(R):5'- CCTGTGAACTCCGACTTAAAGCCC -3'

Sequencing Primer
(F):5'- GCAAAACTGTGGTGAGCTGT -3'
(R):5'- CTGGCAAACCTCTGAGAGTG -3'
Posted On2014-04-24